UA and Ex-527 were acquired from MedChemExpress (Princeton, NJ, USA). The primary antibody against myosin heavy chain (MyHC, MAB4470) was acquired from R&D Systems (Minneapolis, MN, USA). The primary antibodies against STAT3 (#9139), p-STAT3 (Yyr705) (#9145), NF-κB (p65) (#8242), p-NF-κB (p-p65) (Ser536) (#3033), and SIRT1 (#9475) were acquired from Cell Signaling Technology (Beverly, MA, USA); FOXO3a (#10849-1-Ap), FOXO1 (#18592-1-Ap), NOX4 (#14347-1-Ap), and GAPDH (#10494-1-Ap) were acquired from Proteintech (Wuhan, China); and Atrogin-1 (ab168372) and MuRF1 (ab172479) were acquired from Abcam (Cambridge, MA, USA).
Atrogin 1 ab168372
Manufactured by Abcam
Sourced in China
Atrogin-1 (ab168372) is a laboratory product that functions as a ubiquitin ligase, playing a role in the regulation of muscle protein degradation. It is commonly used in research applications.
Automatically generated - may contain errors
Lab products found in correlation
Sirt1, by Cell Signaling Technology (1 mentions)
Mab4470, by R&D Systems (1 mentions)
Ex527, by MedChemExpress (1 mentions)
Gapdh, by Proteintech (1 mentions)
Salubrinal, by Merck Group (1 mentions)
Indoxyl sulfate, by Merck Group (1 mentions)
Lipofectamine r 2000 reagent, by Thermo Fisher Scientific (1 mentions)
β actin gtx109639, by GeneTex (1 mentions)
Bip 610978, by BD (1 mentions)
2 protocols using atrogin 1 ab168372
1
Molecular Mechanisms of Muscle Atrophy
2
Indoxyl Sulfate-Induced Muscle Atrophy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Indoxyl sulfate (IS), N‐Acetyl‐l‐cysteine (NAC), 2′,7′‐dichlorofluorescin diacetate (DCF‐DA), and salubrinal were purchased from Sigma‐Aldrich. The following antibodies were used: Phospho‐eIF2α (Ser51) (9721S) and Phospho AKT (Ser473) (9271S) from Cell Signalling Technology (Danvers, MA); eIF2α (D‐3) and MYH (H‐300) from Santa Cruz Biotechnology (Dallas, TX); BiP (610978) from BD Biosciences; myoG (GTX63352), GAPDH (GTX100118), and β‐actin (GTX109639) from Genetex (Hsinchu City, Taiwan). Atrogin 1 (ab168372) from Abcam (Cambridge, MA); myoD (5.8A) (NB100‐56511) from Novus Biologicals (Littleton CO), and Myc (CSB‐MA000041M0m) from Cusabio (China). AKT1 (C20) was kindly provided by Dr. Jim‐Tong Horng of Chang Gung University, Taiwan. Anti‐mouse IgG (H + L) and anti‐rabbit IgG (H + L) antibodies were purchased from Genetex. siRNA against XBP1 (siXBP1:CCUUGUAGUUGAGAACCAGGAGUUA) and scrambled siRNA (siCtrl: medium GC of Stealth negative control duplex) were purchased from ThermoFisher Scientific and transfected into cells with Lipofectamine(R) 2000 reagent (ThermoFisher Scientific), according to the manufacturer's protocol. The Smart Quant Green master mix for real‐time quantitative PCR assay was purchased from Protech (Taipei, Taiwan).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!