For the MS2 reporter analysis, RNA was extracted using the Qiagen RNeasy Mini Kit (#217004). Reverse transcription was performed on the purified RNA with the ProtoScript First Strand cDNA Synthesis Kit (NEB E6300) using poly(dT) primers. SYBR Green JumpStart Taq Ready Mix (Sigma S9194) with used with qPCR using the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). For nascent RNA analysis, cells were incubated with 0.2 mM 5-ethynyl uridine (EU) at 37°C for 1 hour, then harvested for total RNA extraction at indicated time points. 5 μg total RNA was subjected to nascent transcript isolation by using Click-iT Nascent RNA Capture Kit (Thermo Fisher Scientific, C10365). After reverse transcription, 1 μL cDNA from each sample was used for qPCR by using Power SYBR™ Green PCR Master Mix (Thermo Fisher Scientific) and QuantStudio 6 Flex Real-Time PCR System.
Quantstudio 6 flex real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, China, Japan, United Kingdom, Germany, Canada, Ireland, Singapore, Australia, Switzerland, Italy
The QuantStudio 6 Flex Real-Time PCR System is a high-performance, flexible instrument designed for gene expression analysis, genotyping, copy number variation, and other real-time PCR applications. The system features a 96-well format, supports multiple sample types, and offers a range of interchangeable block formats to meet diverse experimental needs.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (330 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (270 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (218 mentions)
Trizol, by Thermo Fisher Scientific (166 mentions)
Rneasy mini kit, by Qiagen (165 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (123 mentions)
Iscript cdna synthesis kit, by Bio-Rad (91 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (82 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (63 mentions)
Sybr green master mix, by Thermo Fisher Scientific (57 mentions)
Rneasy plus mini kit, by Qiagen (55 mentions)
Power sybr green master mix, by Thermo Fisher Scientific (50 mentions)
Taqman probe, by Thermo Fisher Scientific (47 mentions)
Rneasy kit, by Qiagen (44 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (42 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (38 mentions)
Primescript rt reagent kit, by Takara Bio (38 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (37 mentions)
Sybr select master mix, by Thermo Fisher Scientific (35 mentions)
Verso cdna synthesis kit, by Thermo Fisher Scientific (32 mentions)
1 491 protocols using quantstudio 6 flex real time pcr system
1
MS2 Reporter Analysis of Nascent RNA
2
Quantitative Assessment of Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The isolation of total RNA and synthesis of first-strand cDNA were performed following our previous study [31 ]. To check gene and MIR156b expression, qRT–PCR analysis was performed using a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Life Technologies, Carlsbad, CA, USA) according to the protocol recommended by Applied Biosystems using SYBR Premix Ex Taq (Takara Bio, Beijing, China). VvACTIN [62 (link)] and VvUBI [63 ] served as internal controls. AtACTIN was used as a reference control for semi-qRT–PCR in Arabidopsis [64 (link)].
cDNAs were synthesized using an miR156 stem-loop primer and SuperScript III RT–PCR technology to assess the expression of mature miR156b using stem-loop qRT–PCR. As previously stated, a specific reverse transcription primer for mature miRNAs with a stem-loop structure was created [65 (link)]. qRT–PCR reactions (20 μl containing 10 ng cDNA and the vv-miR156b/stem-loop universal-R primer set) were processed using the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Life Technologies, Carlsbad, CA, USA), as described above. Here, 5.8S rRNA and U6 were used as the reference [66 (link)]. Each reaction was conducted in three independent biological replicates and verified using melting curve analysis. The relative expressions were calculated using the 2−ΔΔCT method. Primers used are listed inSupplementary Data Table S1 .
cDNAs were synthesized using an miR156 stem-loop primer and SuperScript III RT–PCR technology to assess the expression of mature miR156b using stem-loop qRT–PCR. As previously stated, a specific reverse transcription primer for mature miRNAs with a stem-loop structure was created [65 (link)]. qRT–PCR reactions (20 μl containing 10 ng cDNA and the vv-miR156b/stem-loop universal-R primer set) were processed using the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Life Technologies, Carlsbad, CA, USA), as described above. Here, 5.8S rRNA and U6 were used as the reference [66 (link)]. Each reaction was conducted in three independent biological replicates and verified using melting curve analysis. The relative expressions were calculated using the 2−ΔΔCT method. Primers used are listed in
3
Quantifying miRNA and mRNA Expressions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For miRNA-based qRT-PCR analysis, 2 μL of RNA was reverse-transcribed using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) in a total reaction volume of 10 μL. qRT-PCR was performed with MicroRNA Assay Kits and TaqMan Universal Master Mix II, no UNG (Applied Biosystems) using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). All results were expressed as 2−ΔΔCt. The expression of tissue derived miRNAs was normalized against U6 (Ambion, Austin, TX), while serum derived miRNAs were normalized to cel-miR-39 (Qiagen).
For mRNA qRT-PCR analysis, total RNAs were reverse transcribed to cDNA using the Advantage RT PCR Kit (Clontech Laboratories, Inc., Mountain View, CA, USA). qRT-PCR was performed with Power SYBR Green Master Mix (Life Technology, USA) using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). All results were expressed as 2−ΔΔCt and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression. All primer sequences are described in theSupplemental Table 6 .
For mRNA qRT-PCR analysis, total RNAs were reverse transcribed to cDNA using the Advantage RT PCR Kit (Clontech Laboratories, Inc., Mountain View, CA, USA). qRT-PCR was performed with Power SYBR Green Master Mix (Life Technology, USA) using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). All results were expressed as 2−ΔΔCt and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression. All primer sequences are described in the
4
Quantifying Bacterial Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial cell cultures were collected in a time-course manner as indicated, and the cell pellets were stored at −80°C before use. The bacterial total RNA kit (ZOMANBIO) was used for total RNA extraction from frozen cell pellet samples. The integrity of the resulting RNA samples was validated by agarose gel electrophoresis. RNA sample concentration and purity were measured by NanoPhotometer™ (Implen). Only qualified RNA samples were used for subsequent experiments. cDNA was synthesized from 500 ng RNA samples by using FastKing-RT SuperMix (TIANGEN). The resulting cDNA was diluted 500 times and used as the template for subsequent quantitative PCR. Reverse transcription quantitative PCR was performed with gene-specific primers using RealStar Green Fast Mixture (Genstar) and a QuantStudio™ 6 Flex Real-Time PCR System (Thermal Fisher Scientific; pre-denature stage, 95°C, 10 min; PCR stage, denature, 95°C, 15 s; anneal and elongate, 60°C, 1 min; 40 cycles). The 16S rRNA gene was used as internal reference to normalize the expression level of the wild-type and mutated mucR1 genes. The specificity and reliability of primers were assessed by melting curves and Sanger sequencing of RT-qPCR products. Algorithm 2–ΔCq was used to quantify the target gene's transcription level relative to the 16S rRNA gene. Three independent experiments were performed.
5
RT-qPCR Protocol for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 2 μg of total RNA in a 20 μL reaction was converted to cDNA with a SuperScript III Reverse Transcriptase (Invitrogen, Waltham, Massachusetts, USA) by the manufacturer’s instructions on an Eppendorf Mastercycler thermocycler (Eppendorf AG, Germany) with the following conditions: 25 °C for 5 min, 50 °C for 60 min, 70 °C for 15 min, followed by a hold at 4 °C until use in a qPCR reaction. A total of 60 μL of deionized water was added into 20 μL cDNA, and 1 μL of diluted cDNA mixture was used as the input for the qPCR reaction. qPCR reactions were made with a SuperReal PreMix Plus SYBR Green Kit (TIANGEN Biotech, BeiJing, China) following manufacturer’s instructions in a 20 μL volume. qPCR was done on an Applied Biosystems™ QuantStudio™ 6 Flex Real-Time PCR System (ThemoFisher Scientific, Waltham, Massachusetts, USA) with the following cycling conditions: 95 °C for 15 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 32 s. The melt curve conditions were 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 sec. All samples had only one melt temperature peak. The log2fold change was calculated by the 2-ΔΔCT method using 26S as a reference gene. The CT values represent the average of three technical replicates. The sequences of primers used for RT-qPCR are listed in Supplementary Table S4 .
6
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One μL of prepared cDNA mixture was used for qRT-PCR in a 20 μL volume with SuperReal PreMix Plus SYBR Green Kit (TIANGEN Biotech, China), according to the manufacturer’s instructions. The reaction was carried out on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR System (ThemoFisher Scientific, USA) and the cycling conditions was as follows: first at 95 °C for 15 min, then 40 cycles of at 95 °C for 10 s, at 60 °C for 20 s, and finally at 72 °C for 32 s. The melt curves were performed at 95 °C for 15 s, at 60 °C for 1 min, and at 95 °C for 15 s. The 2-ΔΔCT method was used to calculate Log2fold change with DoActin gene as an internal reference [13 (link),68 (link)]. CT values stand for the average of cycle times from three technical replicates. The primer sequences used for qRT-PCR are listed in Table S4 .
7
Quantitative Real-Time PCR of IκBα Induction
8
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues using the RNeasy Mini Kit (Qiagen, #74106). RNA concentration was measured using the Qubit RNA Broad Range Assay Kit (ThermoFisher, #Q10211 ). cDNA synthesis was performed using SuperScript VILO Master Mix (ThermoFisher, #11755-250) with 600 ng total RNA as input. Quantitative reverse transcription (qRT)–PCR was performed using SYBR Green Master Mix (ThermoFisher, #4367659) on a QuantStudio6 Flex Real-Time PCR System (ThermoFisher). Relative expression was determined using the ∆∆CT method and Rpl32 as normalization control. The following primers were used:
DptA-forward: CCACGAGATTGGACTGAATG
DptA-reverse: GGTGTAGGTGCTTCCCACTT
S6K-forward: ACTGGGCGCTCTCATGTTTG
S6K-reverse: TTGGCTTTCAGAATGGTCT
Rpl32-forward: ATATGCTAAGCTGTCGCACAAATGG
Rpl32-reverse: GATCCGTAACCGATGTTGGGCA
DptA-forward: CCACGAGATTGGACTGAATG
DptA-reverse: GGTGTAGGTGCTTCCCACTT
S6K-forward: ACTGGGCGCTCTCATGTTTG
S6K-reverse: TTGGCTTTCAGAATGGTCT
Rpl32-forward: ATATGCTAAGCTGTCGCACAAATGG
Rpl32-reverse: GATCCGTAACCGATGTTGGGCA
9
Quantification of Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the HMC3 cells with a Trizol LS Reagent Kit (Life Technologies, Milan, Italy) and then quantified with a NanoDrop Lite spectrophotometer (Thermo Fisher, Milan, Italy). A total of 1 μg of total RNA was reverse-transcribed in a final volume of 20 μL by using the Superscript IV RT Master Mix (Invitrogen, Carlsbad, CA, USA). A total of 1 μL of cDNA was added to the BrightGreen qPCR Master Mix (ABM, Richmond, BC, Canada) together with specific primers at the concentration of 10 μM in a total volume of 20 μL/well to evaluate IL-1β, IL-6, Il-10, NLRP3, Caspase-1, and TNF-α mRNA expression. A qPCR reaction was monitored by using the QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher, Milan, Italy); GAPDH was used as housekeeping gene and the amplified PCR products were quantified by measuring the cycle thresholds (CT) of the target genes and GAPDH. After normalization, the mean value of the control group was chosen as the calibrator and the results were expressed according to the 2−ΔΔCt method, as a fold change relative to the calibrator [29 (link),30 (link),31 (link),32 (link)]. Primers used for targets and reference genes are listed in Table 1 .
10
Inflammatory Cytokines and NET Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Several molecules associated with inflammation (cytokines), neutrophil extracellular traps (NETs), and the possible downstream signals from mouse organs and the cell culture were evaluated by real time polymerase chain reaction (RT-PCR). Gene expression of several molecules, including inflammatory cytokines; TNF-α, IL-6, and IL-10, genes of NETs formation; peptidyl arginine deiminase 4 (PAD4) and IL-1β, genes of the downstream signals; spleen tyrosine kinase (Syk) and nuclear factor kappa B (NFκB), were evaluated. Total RNA was prepared from the samples with an RNA-easy mini kit (Qiagen, Hilden, Germany) and was quantified by Nanodrop 100 Spectrophotometer (Thermo Scientific) before the determination of gene expression. Total RNA reverse transcription was processed with a High-Capacity cDNA Reverse Transcription (Thermo Scientific). Samples were performed using SYBR Green PCR Master Mix for quantitative RT-PCR with QuantStudio6 Flex Real-time PCR System (Thermo Scientific), respectively. The results were demonstrated in terms of relative quantitation of the comparative threshold (delta-delta Ct) method (2-ΔΔCt) as normalized by β-actin (an endogenous housekeeping gene). The list of primers is shown in Supplementary Table 1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!