SMARTpool siRNA against Smad1 and P300 (Thermo) was transfected into EpiSCs using Dharmafect (Thermo) transfection reagent and mixed in OptiMEM basal media (Life Technologies) (10% dilution of Dharmafect in OptiMEM). Final concentrations of siRNA exposed to cells ranged from 25 to 100 nM.
Dharmafect
Manufactured by Thermo Fisher Scientific
Sourced in United States
DharmaFECT is a transfection reagent for delivering siRNA, miRNA, and plasmid DNA into mammalian cells. It is designed to enable efficient and reliable gene knockdown and expression studies.
Automatically generated - may contain errors
Lab products found in correlation
Opti mem, by Thermo Fisher Scientific (6 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions)
Dharmafect 1, by Horizon Discovery (4 mentions)
Polyethylenimine (pei), by Merck Group (4 mentions)
Smartpool, by Thermo Fisher Scientific (3 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (3 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Dharmafect no 1 reagent, by Horizon Discovery (2 mentions)
Mafa rnai oligonucleotides, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480 2, by Roche (2 mentions)
Dna free rna kit, by Zymo Research (2 mentions)
Gm csf, by R&D Systems (2 mentions)
On targetplus non targeting pool, by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Sirnas, by Thermo Fisher Scientific (2 mentions)
Proximity ligation assay kit, by Olink (2 mentions)
Nbt bcip developing substrates, by Promega (2 mentions)
4 6 diamino 2 phenylindole dapi, by Merck Group (2 mentions)
Fluo 4 am, by Thermo Fisher Scientific (2 mentions)
82 protocols using dharmafect
1
Knockdown of Smad1 and P300 in EpiSCs
2
Knockdown of DKK-1 and MAPK Signaling Pathways in PC3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sub-confluent PC3 cells in six-well dishes were transfected with the following siRNAs using Dharmafect (Thermo Scientific, Waltham, MA, USA): DKK-1 siRNA ID#s: s22723 and s22721 (Ambion, Life Technologies, Carlsbad, CA, USA); MAPK11 siRNA ID#s: MAPK11HSS183382, MAPK11HSS183383 and MAPK11HSS183384 (Invitrogen, Life Technologies, Carlsbad, CA, USA); MAPK12 siRNA ID#s: MAPK12HSS109466, MAPK12HSS109467 and MAPK12HSS109405 (Invitrogen, Life Technologies, Carlsbad CA, USA); MAPK14 siRNA ID#s: s3585, s3586 and s3587 (Ambion, Life Technologies, Carlsbad, CA, USA). Per six-well transfection, 100 nM siRNA were diluted in 50 μl of OPTI-MEM and 2 μl (should be 100 nM amount as varied) of Dharmafect (Invitrogen) in 100 μl of OPTI-MEM. SiRNA and Dharmafect dilutions were incubated at room temperature for 5 min. The diluted siRNA was then combined with the diluted Dharmafect at a ratio of 1 : 2, and incubated at room temperature for 20 min. Cells were washed twice with HBSS and medium replaced with 850 μl of OPTI-MEM supplemented with 10% FCS. In all, 150 μl of the siRNA and Dharmafect mixture was then introduced drop-wise to the cells. After 5 h, the Dharmafect mixture was replaced with the normal culture medium containing both FCS and P/S. The cells were further cultured for 24 h before supernatant was collected and cells lysed for either protein or RNA analysis.
3
Optimized siRNA Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNAs (pool of four) directed against the indicated genes were obtained from Dharmacon (ON-TARGET plus human KPNA2, #L-004702-00-0005; KPNB1, #L-017523-00-0005; IPO4, #L-009516-01-0005; IPO7, #L-012255-00-0005). For example, 3.5 × 105 cells were transfected according to the manufacturer’s protocol using 2 μL of DharmaFECT and 10 μL of 5 μM siRNA pool for 24 h in serum-free medium (Life Technologies) in six-well plates. The cells were then split for cytotoxicity assays and western blot analysis. Transfections were performed in triplicate for each condition. Cytotoxicity assays for gene-silenced cells were performed as previously described.
4
Monitoring Ras-PDEδ Interaction by FRET
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
80,000 HEK293 EBNA cells were seeded in 12 well plates onto sterile cover slips. The next day cells were transfected either with pmGFP-NRasG12V only (donor control) or with FRET pair plasmids pmGFP-NRasG12V and pmCherry-PDEδ at a ratio of 1:3 (1 μg plasmids total). JetPRIME transfection reagent (Polyplus transfection) was used according to the manufacturer’s instructions. ICMT or non-targeting SMARTpool siRNAs (Dharmafect, Life Technologies) were transfected together with the FRET pair plasmids. Alternatively, cells were treated with 2.5 μM deltarasin 24 h after transfection. Scrambled siRNA in 0.1% DMSO served as control. After 24 h of treatment cells were fixed with 4% PFA for 12 min and mounted with Mowiol 4-88 (#81381; Sigma-Aldrich). The lifetime of the donor mGFP was measured using a fluorescence microscope (Zeiss AXIO Observer D1) with fluorescence lifetime imaging attachment from Lambert Instruments as previously described in (Guzmán et al, 2016 (link); Posada et al, 2017) (link). At least 50 cells were selected to measure the lifetime in each sample. The apparent FRET efficiency percentage (Eapp) was calculated using the equation Eapp = (1 − τDA/τD) × 100%, where τDA is the lifetime of the donor in the presence of acceptor (FRET-sample) and τD is the lifetime of the donor only.
5
siRNA Knockdown of EGFP and Chd4 in mESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The siRNAs against EGFP and Chd4 were synthesized and annealed by ST Pharm (Korea). Their sequences are presented in Supplementary Table S1 . mESCs were transfected with 50 nM of the indicated siRNA using DharmaFECT I (T-2001-03; Dharmacon, USA) according to the manufacturer’s protocol. Briefly, mESCs were seeded to 6-well plates. One day later, 50 nM of siRNAs and DharmaFECT reagent were separately diluted in Opti-MEM (Gibco) and incubated at 25°C for 5 min, and then mixed together. The mixtures were incubated at 25°C for 20 min and added to the mESC cultures. The culture medium was replaced after 24 h. Transfected mESCs were harvested at 48 h after transfection, and knockdown efficiency was analyzed by real-time quantitative polymerase chain reaction (RT-qPCR).
6
siRNA Knockdown of EGFP and Chd4 in mESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The siRNAs against EGFP and Chd4 were synthesized and annealed by ST Pharm (Seoul, Korea).
Their sequences are presented in Supplementary Table 5. mESCs were transfected with 50 nM of the indicated siRNA using DharmaFECT I (T-2001-03, Dharmacon) according to the manufacturer's protocol. Briefly, mESCs were seeded to 6-well plates. One day later, 50 nM of siRNAs and DharmaFECT reagent were diluted in Opti-MEM (Gibco), incubated separately at 25°C for 5 min, and then mixed together. The mixtures were incubated at 25°C for 20 min and added to the mESC cultures. The culture medium was replaced after 24 hours. Transfected mESCs were harvested at 48 hours after transfection, and knockdown efficiency was analyzed by real-time quantitative polymerase chain reaction (RT-qPCR).
Their sequences are presented in Supplementary Table 5. mESCs were transfected with 50 nM of the indicated siRNA using DharmaFECT I (T-2001-03, Dharmacon) according to the manufacturer's protocol. Briefly, mESCs were seeded to 6-well plates. One day later, 50 nM of siRNAs and DharmaFECT reagent were diluted in Opti-MEM (Gibco), incubated separately at 25°C for 5 min, and then mixed together. The mixtures were incubated at 25°C for 20 min and added to the mESC cultures. The culture medium was replaced after 24 hours. Transfected mESCs were harvested at 48 hours after transfection, and knockdown efficiency was analyzed by real-time quantitative polymerase chain reaction (RT-qPCR).
7
Transfection of miRNA mimics and inhibitors in hypoxia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SLK and SLKK cells were seeded at a concentration of 6 to 9x105 cells in a10cm dish in DMEM medium with 10% FBS containing no antibiotics; this allowed cells to achieve 50% confluence the following day. The culture medium was then removed and the cells were transfected with the miRNA mimics (i.e. miR-210), miRNA inhibitors (i.e. anti-210) or negative controls (Dharmacon, Lafayette, CO, USA) at 10nM final concentration, using Dharmafect 1 (Dharmacon). Dharmafect 1 is a potent transfection reagent that allows the negatively charged membrane to interact with the liposome/nucleic acid complex. The miRNA transfection experiments were performed in a 2.4mL Opti-MEM/Dharmafect mixture and 9.6mL DMEM medium (Invitrogen). The cells were incubated in normoxia or hypoxia (1% O2) for 48hrs at 37°C/5% CO2 before performing RNA isolation and nuclear/cytoplasmic extraction.
8
Silencing S1P Receptors in Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were transfected with a liposome-base reagent Dharmafect (Dharmacon, Lafayette, CO) following manufacturer's guidelines as described [18] (link). Briefly, 100 nM of siRNA, resuspended in Opti-MEM, were mixed with the Dharmafect reagent to obtain RNA-liposome conjugates, and later incubated with cells for 24 h. siRNA duplexes for S1P receptor silencing were the validated siRNA duplexes specific for S1P human receptors, and a negative silencer RNA control (Ambion, Austin, TX): S1P1 (#4143, #145848), S1P2 (#45076, #44984), and S1P3 (#1959, #1875). Real-time PCR was performed to confirm S1P receptors knock-down after 24 h of transfection, as described above. The degree of inhibition rated from 50-90% for S1P1, 50% for S1P2, and 70% for S1P3. Transfected cells were activated and ICAM-1 and COX-2 were analyzed by Western blot.
9
siRNA Knockdown of VHL in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549 cells were treated with siRNA to VHL at 5 nM using Dharmafect for 48 hrs at 21% O2 (Ambion, Inc. Cat#(Lot): non-targeting control #4390843, siRNA 1 VHL #4390824(s14789), siRNA 2 VHL #4392420(s14790), siRNA 3 VHL #4392420(s14791)). RNA was extracted using Quick-RNA MiniPrep Kit column purification (Zymo Research, #R1055), and resuspended in nuclease-free water. cDNA conversion was performed on 20 ng of isolated RNA using the TaqMan (R) MicroRNA Reverse Transcription Kit (Thermo Fisher, #4366596) and custom reverse transcription primers for DQ580854 (context sequence: TGAGGAGCCAATGGGGCGAAGCTACCATC, target sequence: UGAGGAGCCAAUGGGGCGAAGCUACCAUC), DQ590404 (context sequence: TGGTGTATGTGCTTGGCTGAGGAGCCAATGG, target sequence: UGGUGUAUGUGCUUGGCUGAGGAGCCAAUGG), and DQ596992 (context sequence: GCAATAACAGGTCTGTGATGCCCTTAGA, target sequence: GCAAUAACAGGUCUGUGAUGCCCUUAGA). All primers used FAM as a reporter dye and NFQ as a reporter quencher. RT-qPCR using paired primers was performed for 40 cycles, and RQ values were calculated with the ddCt method, with each treatment normalized to its respective endogenous U6 control. Experiments were performed in biological duplicates.
10
Modulating Glioma Cell Survival Through GLI Inhibition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cyclopamine inactivates gli through Smo inhibition, while GANT61 directly prevents gli binding to DNA. Glioma cells were treated with 10, 20, 40 and 80 μM of cyclopamine, 20 and 40 μM GANT61 (Tocris Bioscience), or 0.1 pmol of siRNA against GLI1, GLI2 or GLI3 (ON-TARGETplus SMARTpool, Dharmacon). The siRNA was introduced into the cells using Lipofectamine (Thermo Scientific DharmaFECT) according to the manufacturer's protocol. Lipofectamine alone or previously tested siRNA against TET2 that does not affect glioma cell survival were used to control the possible non-specific transfection toxicity.
Cells were incubated in a 25 ml flask (5*105 cells per a flask) for 48 hours to observe the expression of gli target genes, and on a 24-well plate (2*104 cells per a well) for 120 hours (when cells in the control were reached the monolayer) to study the cell survival. The plates had been stained with the crystal violet for visualization of the cell survival.
In addition, MTS-assay was used to study cell survival. Cells were incubated in a 96-well plate (2*104 cells per a well) for 48 hours with GANT61 or cyclopamine. HeLa (from the Institute of Cytology RAS) was used as a negative control. MTS-reagent (Promega) was added to the plate according to the manufacturer’s protocol. The absorbance at 490nm was detected using EnSpire Multimode Plate Reader (PerkinElmer, USA).
Cells were incubated in a 25 ml flask (5*105 cells per a flask) for 48 hours to observe the expression of gli target genes, and on a 24-well plate (2*104 cells per a well) for 120 hours (when cells in the control were reached the monolayer) to study the cell survival. The plates had been stained with the crystal violet for visualization of the cell survival.
In addition, MTS-assay was used to study cell survival. Cells were incubated in a 96-well plate (2*104 cells per a well) for 48 hours with GANT61 or cyclopamine. HeLa (from the Institute of Cytology RAS) was used as a negative control. MTS-reagent (Promega) was added to the plate according to the manufacturer’s protocol. The absorbance at 490nm was detected using EnSpire Multimode Plate Reader (PerkinElmer, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!