Polyjet

293T cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) with 10% fetal calf serum. 293T cells at 70% confluence in a 10-cm-diameter dish were transfected with 10 μg pCANmycUSP7 expressing WT USP7 or D762R/D764R (MRGR) USP7 or with pcDNA3.1 (negative control), in each case using 20 μl PolyJet (SignaGen Laboratories) transfection reagent. Cells were transferred to a 15-cm-diameter dish 24 h post-transfection and harvested 48 h post-transfection. For experiments on USP7-ICP0 interactions, 293T cells were co-transfected with 1 μg pCANmycUSP7 expressing WT or D762R/D764R (MRGR) USP7 and either 1 μg pCI-110 ICP0 or 1 μg pcDNA3.1. For controls lacking USP7, 1 μg pCI-110 ICP0 was co-transfected with 1 μg pcDNA3.1. In each case 4 μl PolyJet (SignaGen Laboratories) transfection reagent was used.

For co-IPs and electrophysiological studies, tsA-201 cells were transfected using Fugene6 (Promega, Fitchburg, WI) according to the manufacturer’s protocol. For immuno-cytochemistry, tsA-201 cells were transfected using PolyJet (SignaGen) according to the manufacturer’s protocol. N2A cells were re-plated onto poly-lysine coated coverslips and transfections were carried out using PolyJet (SignaGen) at a ratio of 3:1 to DNA mix according to manufacturer’s instructions. For all electrophysiology and imaging experiments transfections, the cDNA mix consisted of cDNAs encoding WT or D122A Ca_V2.2, β1b, α₂δ-1 in a ratio of 3:2:2. The α₂δ-1 was replaced with Cachd1 or empty vector where appropriate. When these experiments involved both α₂δ-1 and Cachd1, Ca_V2.2, β1b, α₂δ-1 and Cachd1 were added in a ratio of 3:2:2:2, with empty vector replacing α₂δ-1 or Cachd1 where appropriate. For co-IP experiments Ca_V2.2 (with or without GFP and HA tags, as stated), β1b and α₂δ-1 were transfected in a ratio of 2:1:2. For co-IP competition experiments the transfection mix contained Ca_V2.2: β1b: α₂δ-1: (TASK3, Cachd1 or a 1:1 mix of both) in a ratio of 2:1:2:1. For reverse co-IP experiments, Cachd1_GFP, β1b, and Ca_V2.2 were transfected in a ratio of 2:1:2.

For silencing of TSG101, three shRNA duplexes were designed as follows:
shTSG101#1‐F:
GATCGCAGTTCCAGGGAACTAATTTCAAGAGAATTAGTTCCCTGGAACTGCTTTTTTG
shTSG101#1‐R:
AATTCAAAAAAGCAGTTCCAGGGAACTAATTCTCTTGAAATTAGTTCCCTGGAACTGC
shTSG101#2‐F:
GATCGCTTATTCAGGTCATGATTTTCAAGAGAAATCATGACCTGAATAAGCTTTTTTG
shTSG101#2‐R:
AATTCAAAAAAGCTTATTCAGGTCATGATTTCTCTTGAAAATCATGACCTGAATAAGC
shTSG101#3‐F:
GATCGGATGTCTTCCTGAAGCATTTCAAGAGAATGCTTCAGGAAGACATCCTTTTTTG
shTSG101#3‐R:
AATTCAAAAAAGGATGTCTTCCTGAAGCATTCTCTTGAAATGCTTCAGGAAGACATCC
Control‐F:
GATCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTG
Control‐R:
AATTCAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAA
The shRNA oligomers and nontargeting oligomers (control) were annealed and then subcloned into the pLV‐shRNA vector by the BamH I and EcoR I cloning sites. Cell transfection was performed with a PolyJet (SignaGen, Gaithersburg, MD, USA) as described in the manufacturer's protocol. Cell transfection was carried out by PolyJet (SignaGen, Gaithersburg, MD, USA) according to the manufacturer's instructions. The lentiviruses were produced by co‐transfecting the core plasmid and the packaging plasmids in 293T cells.