The DNA of the ileal digesta was extracted with a DNA extraction kit (Axygen Biosciences, Union City, CA, USA), as provided by the manufacturer. Under the same conditions (95 °C for 2 min, followed by 27 cycles at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 60 s and a final extension at 72 °C for 5 min), the V4–V5 region of the 16S rRNA gene was amplified with the primers 515F and 907R. Amplicons were extracted from 2% agarose gels and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to the manufacturer’s instructions. Then, the library was paired-end sequenced using UPARSE version 7.1 and the sequence reads with 97% of sequence similarity were selected to build distinct operational taxonomic units (OTUs) [25 (link)]. The sparse curves of 16S rRNA gene sequences exhibit a tendency towards saturation platforms, ensuring a sufficient sequencing depth for diversity analysis. Analyses based on Mothur (version:1.21.1) revealed 97% of the same alpha diversity indices, including the Chao, ACE, Shannon and Simpson diversity indices. The Bray–Curtis distance was used to perform Principal Coordinate Analysis (PCoA). Linear discriminant effect size analysis (LEfSe) was used to compare the relative microbial community abundance between treatments [26 (link)].
Dna extraction kit
Manufactured by Corning
Sourced in United States, China
The DNA extraction kit is a laboratory equipment designed to isolate and purify DNA from biological samples. It provides a standardized and efficient process to extract DNA, which is a fundamental step in various molecular biology applications, such as genetic analysis, genomic research, and diagnostic testing.
Automatically generated - may contain errors
Lab products found in correlation
Axyprep dna gel extraction kit, by Corning (2 mentions)
Pcr cleanup kit, by Corning (1 mentions)
Genomic dna miniprep kit, by Corning (1 mentions)
Pbs buffer, by Solarbio (1 mentions)
E z n a soil dna kit, by Omega Bio-Tek (1 mentions)
Centrifuge 5430 r, by Eppendorf (1 mentions)
Taq polymerase, by Tiangen Biotech (1 mentions)
Miseq system, by Illumina (1 mentions)
Miseq platform, by Illumina (1 mentions)
48 plex snpscan kit, by Genesky Biotechnologies (1 mentions)
Ta cloning kit, by Thermo Fisher Scientific (1 mentions)
Massarray system, by Labcorp (1 mentions)
Antibodies against hif 1α, by Abcam (1 mentions)
Simplechip kit, by Cell Signaling Technology (1 mentions)
Hif 1β, by Cell Signaling Technology (1 mentions)
28 protocols using dna extraction kit
1
Ileal Microbiome Profiling via 16S Sequencing
2
Molecular Techniques for DNA Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Restriction and DNA modification enzymes were purchased from New England Biolabs or Fermentas. Plasmid DNA was extracted from E. coli or Sulfolobus cells using an AxyPrep Plasmid Miniprep Kit (Wujiang, China). Polymerase chain reaction (PCR) products were purified by using an Axygen PCR Clean-up Kit, and DNA bands fractionated from the agarose gel were extracted by using an Axygen DNA extraction kit. Total DNA was prepared from Sulfolobus by using an Axygen Genomic DNA Miniprep Kit. The oligonucleotides were synthesized by Invitrogen (Shanghai, China) and were also used for DNA sequencing.
3
Fungal Diversity Analysis via ITS2 Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 0.91 g of LJF samples was weighed and transferred into a 50 mL sterilized centrifuge tube, and 25 mL of 1×PBS buffer (Beijing Solarbio Science & Technology Co., Ltd., China) was added. We then shook the tube with the vortex mixer for five minutes and filtered the solution using four layers of sterile gauze. Then, the solution was centrifugated for 28 min to collect the fungal strains (Centrifuge 5430 R, Eppendorf AG, Hamburg, Germany). And we extracted the total DNA by following the manufacturer’s instructions of EZNA® soil DNA kit (Omega Bio-tek., Inc., Norcross, GA, USA). The sequences were amplified by targeting the ITS2 region using the designed primer pairs ITS3 (5′-GCATCGATGAAGAACGCAGC-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) [45 ]. The PCR condition was performed as follows: initial denaturation for 5 min at 94 °C; 40 cycles of denaturation for 30 s at 94 °C, annealing for 30 s at 56 °C and then elongation for 45 s at 72 °C; and final extension for 10 min at 72 °C. Each sample was amplified three times, which were pooled to reduce the PCR bias. Agarose (2%, 447 W/V) gel electrophoresis and DNA extraction kit were used to verify and purify the desired products (Axygen, Union City, CA, USA).
4
Targeted NGS for Deafness Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mutation analysis, genomic DNA of the probands was extracted from peripheral blood using DNA extraction kit (Axygen) and subjected to a targeted NGS including 127 deafness‐related genes (see Table S1 ). Data were analysed in accordance with NGS standard process. Sequence alignment was performed by using BWA 0.6.2‐r126 software. UCSC hg19 Feb.2009 was used as reference genome. Mutation identification was performed by using GATK. dbSNP (snp137) as a reference. The pathogenicity of novel mutations was predicted by using 1000 genome database (phase I), HapMap database (combined data from phases II and III) and own databases as references. Guideline of American College of Medical Genetics and Genomics was used as the reference of data interpretation.17
5
Genetic Deafness Screening Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A DNA extraction kit (AXYGEN) was employed to extract genomic DNA of all family members and 200 controls. Agarose gel electrophoresis was performed for evaluating the quality and quantity of DNA samples according to the routine protocol,
excluding common deafness genes.
In order to exclude mutations of GJB2, SLC26A4, and MtDNA12SrRNA genes, a “SNPscan assay” was employed. This SNPscan assay from Genesky Biotechnologies Inc. (Shanghai, China) was designed to capture a total of 115 mutations of the three common deafness-causing genes [17 (link), 18 (link)]. It was carried out according to the detailed protocol described previously [19 (link)].
excluding common deafness genes.
In order to exclude mutations of GJB2, SLC26A4, and MtDNA12SrRNA genes, a “SNPscan assay” was employed. This SNPscan assay from Genesky Biotechnologies Inc. (Shanghai, China) was designed to capture a total of 115 mutations of the three common deafness-causing genes [17 (link), 18 (link)]. It was carried out according to the detailed protocol described previously [19 (link)].
6
LAPTM4B Genotyping in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from cells and paraffin‐embedded sections using a DNA extraction kit (Axygen, Union City, CA, USA). For each sample, the genotype of LAPTM4B was identified by PCR using the following primers: 5′‐GCCGACTAGGGGACTGGCGGA‐3′ (P1 forward) and 5′‐CGAGAGCTCCGAGCTTCTGCC‐3′ (P2 reverse). The PCR mixture (25 μL) contained 0.5 U Taq polymerase (TIANGEN, Beijing, China) and 1 μL template DNA at a final concentration of 100 ng·μL−1. Human β‐actin was used as an internal positive control using the following primers: 5‐TCACCAACTGGGACGACAT‐3 (forward), 5‐AGGTAGTCAGTCAGGTCCCG‐3 (reverse). The PCR products were analysed by electrophoresis in a 2.5% agarose gel and visualized with ethidium bromide.
7
Bacterial Genome Sequencing and Annotation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial DNA was isolated using a DNA extraction kit (Axygen, Hangzhou, China). The genome of strain S3-4 was sequenced by Personalbio (Shanghai, China) using an Illumina Miseq system. A combination of three libraries containing 450 bp (paired-end), 3 kb and 8 kb (mate-paired) inserts was sequenced. The generated sequences were assembled using Newbler de novo (version 2.6)32 (link), and the pre-assembled contigs were scaffolded using the SSPACE program33 (link). Gaps between contigs were closed using GapCloser software (version 1.12; http://soap.genomics.org.cn ) and PCR amplification. Prediction of open reading frames (ORFs) was accomplished using Glimmer 3.0 (http://www.cbcb.umd.edu/software/glimmer/ ), whereas RNAmmer 1.234 (link) and tRNAscan-SE (Version 1.3.1)35 (link) were used for the identification of rRNA and tRNA. Functional annotation of genes was done using BLAST2GO software36 (link) and the refseq-protein database (https://www.ncbi.nlm.nih.gov/refseq/ ). A putative function was assigned to each gene using a cutoff E-value of ≤1 E−06. Predicted protein sequences of strains with and without DON-degradation activity, Devosia sp. 17-2-E-825 and Sphingobium japonicum UT2621 (link), respectively, were compared with strain S3-4 using bidirectional BLASTp comparisons with an E value cutoff of 10−5 as previously described37 (link).
8
Genetic Variants in MMP-2 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MMP-2 rs243865(C/T) and rs2287074 (A/G) are located in promoter region and in codon 460 of exon 9, respectively. Genomic DNA was extracted from whole blood with DNA extraction kit (Axygen Biosciences, Union City, USA). The DNA concentration was determined by TU1901 Spectrophotometry (Purkinje General Company, Beijing City, China) to ensure the DNA concentration was greater than 20 μg/ml. The extracted genomic DNA was stored at −80 °C. All gene sequencing were performed by the Shanghai Fenglin Clinical Laboratory Company (http://www.fenglinlab.com/index.asp ) using the Sequenom MassARRAY system (Sequenom, Inc., San Diego, CA, USA).
The primer sequences of MMP-2 rs243865 are:
forward-5′- ACGTTGGATGTGTTCCCTAAAACATTCCCC-3′,
reverse-5′-ACGTTGGATGAGTGACTTCTGAGCTGAGAC-3′, extended-5′-TTCCCCACCCAGCACTC -3′.
The primer sequences of MMP-2 rs2287074 are:
forward-5′-ACGTTGGATGTCTAAGGTCAGGTGTTCTCC-3′,
reverse-5′-ACGTTGGATGTTGCAGATCTCAGGAGTGAC-3′,
extended-5′-GGCACCGGCCCCACCCCCAC-3′.
As a control for the sequencing, blinded blood duplicates were used.
The primer sequences of MMP-2 rs243865 are:
forward-5′- ACGTTGGATGTGTTCCCTAAAACATTCCCC-3′,
reverse-5′-ACGTTGGATGAGTGACTTCTGAGCTGAGAC-3′, extended-5′-TTCCCCACCCAGCACTC -3′.
The primer sequences of MMP-2 rs2287074 are:
forward-5′-ACGTTGGATGTCTAAGGTCAGGTGTTCTCC-3′,
reverse-5′-ACGTTGGATGTTGCAGATCTCAGGAGTGAC-3′,
extended-5′-GGCACCGGCCCCACCCCCAC-3′.
As a control for the sequencing, blinded blood duplicates were used.
9
16S rRNA Gene Sequencing of Fecal Microbiome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microbial DNA from the fecal samples collected from the ICR mice was extracted using a DNA extraction kit according to the manufacturer’s recommended protocols (Axygen Biosciences, Union City, CA, U.S.). Primers 341f 5 ‘- cctacgggrsgcag-3’ and 806r 5 ‘- ggactacvvvgggtatctatc-3’ (with specific barcode in the primer) were used, The V3-V4 region of the bacterial 16S ribosomal RNA genes was amplified by PCR (95°C for 3 min followed by 30 cycles of 98°C for 20 s, 58°C for 15 s, and 72°C for 20 s and a final extension at 72°C for 5 min) using the primers. The PCRs were performed in a 30-µL mixture containing 15 µL of 2× KAPA Library Amplification ReadyMix, 1 µL of each primer (10 µM), 50 ng of template DNA and ddH20. Amplicons were extracted from 2% agarose gels, purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to the manufacturer’s instructions and quantified using Qubit 2.0 (lnvitrogen, USA). After preparation of the library, these tags were sequenced using a MiSeq platform (Illumina, Inc., CA, USA). DNA extraction, library construction and sequencing were conducted at Realbio Genomics Institute (Shanghai, China).
10
Cloning and Characterization of Porcine COX-2 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from PAMs and purified by using a DNA extraction kit (Axygen). The fragment of porcine COX-2 gene promoter flanking the 5’ COX-2 gene (NC_010451.4) was cloned by specific primers listed in Table 1 Table 1 Table 1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!