GST pull-down assay was conducted as described previously with minor modifications57 (link). About 10 μg of purified prey protein was pre-absorbed for 1.5 hr at room temperature in 1 mL binding buffer containing 15 μL of Glutathione Sepharose 4 Fast Flow (GE Healthcare), 50 mM Tris-HCl (pH 7.5), 250 mM NaCl, 0.6% (v/v) Triton X-100, 1 × protease inhibitor cocktail, 0.2% (v/v) glycerol, and 5 mM DTT. After centrifugation, the supernatant was incubated with 10 μg of bait protein and another 15 μL Glutathione Sepharose 4 Fast Flow (GE Healthcare) for 3 hr at room temperature. The column was then washed with buffer containing 50 mM Tris-HCl (pH 7.5), 250 mM NaCl, 0.6% (v/v) Triton X-100, and protease inhibitor cocktail, bound proteins were eluted by boiling in 60 μL SDS-containing buffer and subjected to Western blot analysis.
Glutathione sepharose 4 fast flow
Manufactured by GE Healthcare
Sourced in United States, United Kingdom, Sweden
Glutathione Sepharose 4 Fast Flow is a chromatography matrix designed for the purification of proteins fused with glutathione S-transferase (GST). It consists of cross-linked agarose beads to which glutathione has been coupled. The matrix is optimized for fast flow rates and high capacity.
Automatically generated - may contain errors
Lab products found in correlation
Amylose resin, by New England Biolabs (5 mentions)
Nocodazole, by Merck Group (4 mentions)
Protein a sepharose cl 4b, by GE Healthcare (4 mentions)
Protease inhibitor mixture tablets complete edta free, by Roche (4 mentions)
Puromycin, by Merck Group (4 mentions)
Pgex 6p 1 vector, by GE Healthcare (3 mentions)
Superdex 75, by GE Healthcare (3 mentions)
Lightshift chemiluminescent emsa kit, by Thermo Fisher Scientific (3 mentions)
Restriction enzyme, by New England Biolabs (3 mentions)
Pd 10 desalting column, by GE Healthcare (3 mentions)
Ni nta agarose, by Qiagen (3 mentions)
Anti his and anti gst antibodies, by Abmart (3 mentions)
Ni nta agarose bead, by Qiagen (3 mentions)
Oligonucleotide, by Merck Group (3 mentions)
L4610, by Promega (2 mentions)
Neg709a500uc, by PerkinElmer (2 mentions)
Protease inhibitor cocktail, by Roche (2 mentions)
Imperial protein stain, by Thermo Fisher Scientific (2 mentions)
Pierce bicinchoninic acid bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Amicon ultra concentrator, by Merck Group (2 mentions)
85 protocols using glutathione sepharose 4 fast flow
1
GST Pull-Down Assay for Protein-Protein Interactions
2
Protein-Protein Interaction Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Forward primer (5′-CGCGGATCCATGACTATCA AATACAA-3′) and reverse primer (5′-CCGCTCGAGTCATACATCTGAATTTG-3′) were used to amplify TYLCCNB βC1. Forward primer (5′-ATAAGAATGCGGCCGCATGTCCTCCTCAA-3′) and reverse primer (5′-CGCGGATCCTCACTCAAATGCC-3′) were used to amplify NtSKP1. Full-length of βC1 was digested by BamHI and XhoI, then cloned into vector pGEX-6P-1, and full-length of NtSKP1 was digested by NotI and BamHI, then cloned into vector pMal-c5x. Then, GST-βC1 and MBP-NtSKP1 fusion proteins were expressed in E. coli (BL21). MBP-NtSKP1 was purified by Amylose resin (NEB), eluted with Elution buffer (20 mM Tris-HCl, 200 mM NaCl, 1 mM DTT, 1 mM EDTA, 10 mM maltose, PH=7.4) and desalted by disposable PD-10 desalting columns (GE Healthcare). GST-βC1 was purified by Glutathione Sepharose 4 Fast Flow (GE Healthcare) and then used to pull down MBP-NtSKP1 invitro for 2 h at 4°C. The beads were washed five times with ice-cold 1×PBS. Then washed beads were boiled with SDS loading buffer for 10 min. Proteins were separated by SDS-PAGE and detected by western blot with anti-MBP tag mouse monoclonal antibodies (Abcam, UK).
3
Protein-Protein Interaction Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AtBIN2 full‐length cDNA was cloned into the pGEX4T‐1 vector with the GST‐tag, and AtJAZ1 full‐length cDNA was cloned into the pET32a vector with the His‐tag. The resulting plasmids were transformed into E. coli strain BL21 (DE3). The recombinant proteins AtBIN2‐GST and AtJAZ1‐His were purified with Glutathione Sepharose™ 4 Fast Flow and Ni Sepharose™ 6 Fast Flow (GE Healthcare, Pittsburgh, PA), respectively, according to the manufacturers’ instructions. The pull‐down assays were performed as described in previous studies (Wang et al., 2011 (link)). Proteins retained on the beads were analysed by immunoblotting with an anti‐GST or anti‐His antibody.
4
GST Fusion Protein Pull-down Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GST fusion proteins were expressed in Escherichia coli strain BL21 (Stratagene), purified using standard procedures and stored at −80°C. Proteins were in vitro translated in presence of [35S] methionine (Perkin-Elmer NEG709A500UC) using the reticulocyte lysate-coupled transcription/translation system (Promega L4610) accordingly to manufacturer's instructions. Translation and labeling quality were monitored by SDS-PAGE. GST protein and GST fusion proteins were immobilized on Glutathione Sepharose 4 Fast Flow (GE Healthcare 17-5132-01) and incubated with the in vitro translated proteins in buffer A (40 mM HEPES at pH 7.5, 5 mM MgCl2, 0.2 mM EDTA, 0.5% NP-40, 100 mM KCl) under rotation for 2 h at 4°C. Beads were washed with buffer A, buffer B (40 mM HEPES pH 7.5, 5 mM MgCl2, 0.2 mM EDTA, 0.5% NP-40, 300 mM KCl) and PBS. After washing, beads were boiled in SDS loading buffer and proteins were resolved by SDS-PAGE. Gels were dried and exposed to X-ray films.
5
Recombinant 14-3-3 Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LvRab11, 14-3-3ES and 14-3-3EL were cloned into the pET-28a (+) vector (Novagen) that already contained an N-terminal 6xHis tag. The protein was expressed in Escherichia coli strain BL21 (DE3) and purified using HisPur Ni–NTA Superflow Agarose (Thermo Scientific) following the manufacturer’s instructions. GST-fusion 14-3-3ε proteins were subcloned into the pGEX-4T-1 vector (Amersham Biosciences). The recombinant GST-14-3-3EL and GST-14-3-3ES proteins were produced in E. coli strain BL21 and purified using Glutathione Sepharose 4 Fast Flow (GE Healthcare) following the manufacturer’s instructions. Purified recombinant proteins were analysed by SDS-PAGE. The protein concentration was measured with a dye-binding assay by the Bradford method and stored at − 20 °C.
6
Recombinant FCA Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence corresponding to the N-terminal of FCA (ATG to 948 bp) containing both RRM domains or FCA full length was amplified from cDNA and inserted into the pGEX-6P-1 vector (GE Healthcare). Freshly transformed cells (E. coli BL21DE3) were grown in terrific broth medium at 37 °C for 6 h, followed by induction of protein expression for 3 h at 30 °C with 1 mM IPTG. The GST-tagged protein was purified from the cells by following a protocol provided with Glutathione Sepharose® 4 Fast Flow (GE Healthcare).
7
Expression and Purification of GII.P16/GII.4 Capsid P Domain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The capsid P domain of two GII.P16/GII.4 Sydney outbreak strains (AB-2016-26 and AB-2016-190) were amplified by RT-PCR using forward primer ACGCGGATCCTCAAGAACTAAACCATTCTCTGTCC and reverse primer ATAAGAATGCGGCCGCTTAGCAAAAGCAATCGCCACGGCAATCGCATACTGCACGTCTACGCCCCGTTCC and cloned into pGEX-4 T-1 vector (GST Gene fusion System, GE Healthcare Life Sciences) between the Bam HI and Not I sites. An RGD4C tag (CDCRGDCFC) was linked to the C terminus of the P domain for P particle formation [22 (link)]. The recombinant P domain protein was expressed in E. coli (BL21, DE3) with induction by 0.25 mM isopropyl-β-D-thiogalactopyranoside (IPTG) at room temperature (~ 21 °C) overnight as described elsewhere [22 (link)]. Purification of the glutathione S-transferase (GST)-P domain fusion protein was performed using resin of Glutathione Sepharose 4 Fast Flow (GE Healthcare Life Sciences) according to the manufacturer’s instruction. GST was removed from the target proteins by thrombin (GE Healthcare Life Sciences) cleavage either on beads or in solution (phosphate buffer saline, PBS, pH 7.4).
8
Coimmunoprecipitation and GST Pull-down Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Coimmunoprecipitations were performed as previously described (Kyei et al., 2009 (link)) with slight modification. In brief, cells were lysed with NP-40 buffer (Life Technologies) containing 1 mM PMSF and protease inhibitor cocktail (Roche) for 45 min followed by centrifugation. Supernatants were incubated for 2 h with antibodies at 4°C. The immune complexes were captured with Dynabeads (Life Technologies). Immunoprecipitates were washed three times with PBS, eluted with Laemmli SDS-PAGE sample buffer, and subjected to immunoblot analysis.
GST and GST-tagged proteins were expressed in Escherichia coli BL21 (DE3) or SoluBL21 (Amsbio). GST and GST fusion proteins were purified and immobilized on glutathione-coupled Sepharose beads (Glutathione-Sepharose 4 Fast Flow; GE Healthcare), and pull-down assays with in vitro translated [35S]-labeled proteins were performed as described previously (Pankiv et al., 2007 (link)). The [35S]-labeled proteins were produced using the TNT T7 Quick Coupled Transcription/Translation System (Promega) in the presence of [35S]l -methionine. The proteins were eluted from washed beads by boiling for 5 min in SDS-PAGE gel loading buffer, separated by SDS-PAGE, and radiolabeled proteins were detected in a bioimaging analyzer (BAS-5000; Fujifilm).
GST and GST-tagged proteins were expressed in Escherichia coli BL21 (DE3) or SoluBL21 (Amsbio). GST and GST fusion proteins were purified and immobilized on glutathione-coupled Sepharose beads (Glutathione-Sepharose 4 Fast Flow; GE Healthcare), and pull-down assays with in vitro translated [35S]-labeled proteins were performed as described previously (Pankiv et al., 2007 (link)). The [35S]-labeled proteins were produced using the TNT T7 Quick Coupled Transcription/Translation System (Promega) in the presence of [35S]
9
Characterizing Human AIP Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human AIP variants listed in Table 1 were obtained by site-directed mutagenesis (QuikChange II XL kit, Agilent Technologies, Santa Clara, CA, USA, 200521) from the p-THREE-E-AIP_WT plasmid [7 (link)]. Under IPTG induction, WT and mutant GST-AIP proteins were produced in BL21-PLyss E. coli and subjected to affinity (Glutathione Sepharose 4 Fast Flow, GE Healthcare, Little Chalfont, UK, 17-5132-02) and gel filtration chromatography. GST was obtained likewise and used as a negative control. Ten micrograms of each synthetic protein were used as baits for individual GST pull-down experiments against 2 mg of total protein from GH3 cells (ECACC, Porton Down, UK, 87012603), and eluates from four independent experiments for each bait protein were pooled together for MS analysis, as reported before [7 (link)].
10
GST-Saw1 and Slx4 Protein Binding
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!