The P. funiculosum NCIM1228 genomic DNA was sequenced using the GS-FLX Titanium platform (Roche/454, Branford, USA). An FLX shotgun library and an 8-kb paired-end library were prepared for sequencing using the GS-FLX Titanium platform (Roche454, Branford, USA). Quality-filtered sequences from whole genome shotgun sequencing were assembled using the GS De Novo Assembler (NEWBLER Version 2.6; Roche). Reads that overlapped each other were joined into contigs. Further genome analysis was performed using these contigs. Protein-coding genes in the P. funiculosum genome were annotated using the MAKER annotation pipeline [49 (link)]. MAKER predicts proteins based on homology with protein-coding sequences of other species and with the consensus of the ab initio gene prediction algorithms SNAP, AUGUSTUS, and GeneMark. For protein prediction, the NCBI NR database (update 05, 2015) and fungal ESTs were used. All predicted proteins were annotated using BLASTP version 2.2.28 + search against the NCBI NR database (with the Swiss-Prot and TrEMBL databases) to assign general protein function profiles using a cutoff E value ≤ 1e−5. InterProScan (http://www.ebi.ac.uk/interpro/ ) and Gene Ontology (GO) (http://geneontology.org/ ) were also used to annotate the predicted proteome.
Gs flx titanium platform
Manufactured by Roche
Sourced in United States, China, Germany
The GS-FLX Titanium platform is a next-generation sequencing system designed for DNA and RNA sequencing. It utilizes 454 sequencing technology to generate high-throughput, long-read sequence data.
Automatically generated - may contain errors
Lab products found in correlation
Minielute pcr purification kit, by Qiagen (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Fastpfu polymerase, by Thermo Fisher Scientific (1 mentions)
Ultraclean microbial dna isolation kit, by Qiagen (1 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Rnalater solution, by Takara Bio (1 mentions)
Genomiphi hy dna amplification kit, by GE Healthcare (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
Mo bio power fecal dna isolation kit, by Qiagen (1 mentions)
3730xl dna analyzer, by Thermo Fisher Scientific (1 mentions)
Hiseq 2000 platform, by Illumina (1 mentions)
Nextera dna sample prep kit, by Illumina (1 mentions)
Agencourt ampure xp bead, by Beckman Coulter (1 mentions)
Gs flx titanium series, by Roche (1 mentions)
Fastdna spin kit for soil, by MP Biomedicals (1 mentions)
Tks gflex dna polymerase, by Takara Bio (1 mentions)
Fastdna spin kit, by MP Biomedicals (1 mentions)
16 protocols using gs flx titanium platform
1
Genome Sequencing and Annotation of P. funiculosum
2
Bacterial Community Profiling via 16S rDNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For each sample, triplicate DNA aliquots were extracted with Power Soil DNA Isolation Kit (MOBIO, USA) according to the manufacturer’s instructions. Bacterial primer set of 8F (5′-3′ GAGTTTGATCCTGGCTCAG ) and 533R (5′-3′ TTACCGCGGCTGCTGGCAC ) was used to amplify the V1–V3 regions of 16S rDNA. Barcodes were incorporated at the 5′ end of the forward primer to allow multiplexing pyrosequencing. The PCRs were carried out in triplicate 20 µL reaction volumes containing 0.5 µL DNA template, 250 µM dNTPs, 0.1 µM of each primer and 2.5 U FastPfu Polymerase (Applied Biosystems) and appropriate 5× FastPfu buffer. The PCR amplification was conducted under the following conditions: initial denaturation at 95°C for 2 min; 25 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s, and a final extension at 72°C for 5 min. PCR amplicon libraries were prepared by combining three independent PCR products for each sample to minimize the impact of potential early round PCR errors. After purification with MiniElute PCR purification kit (Qiagen, Germany), the PCR products were quantified using the GeneQuant pro system (GE Healthcare) and then mixed accordingly to achieve the equal concentration in the final mixture. Then the equalized PCR products were submitted for pyrosequencing on a Roche GS-FLX Titanium platform at Majorbio Bio-pharm Technology (Shanghai, China).
3
Microbiome Analysis of Stool and Mucosal Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stool samples were collected in sterile containers at home before the start of bowel preparation and stored at 4 °C. Upon arrival at the hospital, the stool samples were frozen at −80 °C. Mucosal tissue samples were taken from the ileoceal valve area using sterile endoscopic biopsy forceps during colonoscopic examination and immediately stored at −80 °C. After homogenization, DNA was extracted using a phenol/chloroform extraction method combined with physical disruption of bacterial cells and the UltraClean microbial DNA Isolation kit (Mo Bio Laboratories, Carlsbad, CA, USA). The DNA concentration and quality were determined by agarose gel electrophoresis (1 % wt/vol agarose in Tris-acetate-EDTA buffer) and with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). DNA spanning the V1-V3 region of bacterial 16S rDNA was amplified using a barcoded universal primer (8F 5′-barcode sequence-linker sequence (AC)-GAGTTTGATCMTGGCTCAG-3′ or GGGTTCGATTCTGGCTCAG for Bifidobacterium) and 518R 5′-barcode sequence-linker (AC)- WTTACCGCGGCTGT GG-3′). Sequencing was conducted with Roche GS FLX Titanium platform according to the manufacturer’s specifications (DNA Link Inc., Republic of Korea).
4
Transcriptome profiling of Primula chrysochlora
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh leaves and whole flowers of a P. chrysochlora (Primulaceae) plant growing in Tengchong, Yunnan Province, China (25 21′05.74′N, 98 08′18.90′E, alt. 1810 m), were sampled and immediately stored in RNAlater solution (Takara Biotechnology Co., Ltd.) to preserve the RNA. Total RNA was subsequently extracted using a modified hexadecyltrimethylammonium bromide (CTAB) method. Quantified total RNA (concentration ≥100 ng/µL; rRNA ratio ≥1.5) was delivered to Macrogen, where cDNA sequencing was performed with the Roche GS FLX Titanium platform. Raw data were filtered for adapters, low-quality reads, or short reads below 40 bp. For P. chrysochlora, 428,716 cleaned reads with average length of 368 bp (range: 40–1044 bp) were obtained and deposited in the Sequence Reads Archive (SRA) database under accession number SRX1037980.
5
Mitochondrial DNA Sequencing by 454
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
454 sequencing was performed at Eurofins MWG Operon (Ebersberg, Germany). About 100 ng of isolated mtDNA were pre-amplified using the GenomiPhi HY DNA Amplification Kit (GE Healthcare, Chalfont St Giles, UK). Then, samples were nebulized, emulsionPCR performed and single-end read libraries sequenced on a Roche/GS FLX Titanium platform (Roche Diagnostics GmbH, Manheim, Germany).
6
Ig-VH Gene Enrichment and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mSG tissue using the RNeasy Mini Kit (Qiagen); the concentration/purity of RNA samples were measured using the Nanodrop 20C (Lab Tech, UK) and the quality was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, UK). To enrich for the Ig-VH genes, cDNA was synthesised using specific primers designed on the constant Ig-m, -g and -a domains (23) (link) (Supplementary Table S2) using 100 ng of total RNA and the Superscript III Reverse Transcriptase (Invitrogen) following the manufacturer's instructions. Thirty-six amplicon libraries were generated per sample, using the whole retro-transcribed RNA, 12 VH consensus forward primers, 3 Ig-m, -g and -a reverse primers (23) modified with a unique multiplex identifier (MID) tag (Suppl. Table S2) and the Q5 High Fidelity DNA polymerase (NEB) according to the following conditions: a denaturation at 98°C for 1' followed by 33 cycles (for g-m isotypes) or 36 cycles (for a isotype) of 98°C for 30'' and 72°C for 45'' followed by a final extension of 72°C for 2'. Amplicons were purified using the Agentcourt AMPure beads kit (Beckam Coulter), quantified using the Quanti-iT PicoGreen Assay kit (Thermo Fischer scientific), pooled and then sequenced using the Roche GS-FLX titanium platform, following the manufacturer's instructions for the Titanium series (454 Life Science, Roche) (Supplementary Fig. S2a).
7
Fecal Microbiome DNA Extraction and 16S Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen fecal samples were thawed on ice and dissected. To avoid soil
contamination, DNA was then extracted from the inner part of the fecal samples
(0.25 g) using the MO BIO PowerFecal™ DNA Isolation Kit (MO BIO
Laboratories, Carlsbad, CA, USA) according to the manufacturer’s
instructions and the DNA concentration was measured by using Nanodrop (Thermo
Scientific). DNA pyrosequencing was performed at the Beijing Genomics Institute
(BGI Shenzhen, China) via 454 Life Sciences/Roche GS FLX Titanium platform.
Briefly, DNA was amplified by using the V1–V3 hypervariable regions of
the bacterial 16S rRNA gene bar-coded primers (forward: CCGTCAATTCMTTTGAGTTT,
reverse: ACTCCTACGGGAGGCAGCAG). The PCR reaction (50 μl)
contained 50 ng DNA, 41 μl molecular biology grade
water, 5 μl 10 x FastStart High Fidelity Reaction Buffer
containing 18 mM MgCl2, 1 μl dNTPs
(10 mM each), 1 μl Fusion Primer A (10 mM),
1 μl Fusion Primer B (10 mM), and 1 μl
FastStart High Fidelity Enzyme Blend (5 U/ml). PCR cycles included
95 oC for 2 min; 30 cycles of
95 oC for 20 s, 50 oC
for 30 s, and 72 oC for 5 min; and a
final extension at 72 oC for 10 min.
contamination, DNA was then extracted from the inner part of the fecal samples
(0.25 g) using the MO BIO PowerFecal™ DNA Isolation Kit (MO BIO
Laboratories, Carlsbad, CA, USA) according to the manufacturer’s
instructions and the DNA concentration was measured by using Nanodrop (Thermo
Scientific). DNA pyrosequencing was performed at the Beijing Genomics Institute
(BGI Shenzhen, China) via 454 Life Sciences/Roche GS FLX Titanium platform.
Briefly, DNA was amplified by using the V1–V3 hypervariable regions of
the bacterial 16S rRNA gene bar-coded primers (forward: CCGTCAATTCMTTTGAGTTT,
reverse: ACTCCTACGGGAGGCAGCAG). The PCR reaction (50 μl)
contained 50 ng DNA, 41 μl molecular biology grade
water, 5 μl 10 x FastStart High Fidelity Reaction Buffer
containing 18 mM MgCl2, 1 μl dNTPs
(10 mM each), 1 μl Fusion Primer A (10 mM),
1 μl Fusion Primer B (10 mM), and 1 μl
FastStart High Fidelity Enzyme Blend (5 U/ml). PCR cycles included
95 oC for 2 min; 30 cycles of
95 oC for 20 s, 50 oC
for 30 s, and 72 oC for 5 min; and a
final extension at 72 oC for 10 min.
8
Isolation and Sequencing of Aphelenchus avenae Genome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aphelenchus avenae was reared on plant pathogenic fungus Rhizoctonia solani reared on a substrate of autoclaved wheat19 . The nematodes were washed using distilled water, collected on filter, and then harvested by 30% sucrose float to remove contaminants. Aliquots of nematodes were preserved at −80 °C. To isolate the genomic DNA, the nematodes were lysed by lysis buffer, containing 0.1 M Tris-Cl pH 8.5, 0.1 M NaCl, 50 mM ethylenediaminetetraacetic acid (EDTA) pH 8.0, 1% sodium dodecyl sulfate (SDS), treated with Protease K. Then the phenol/chloroform extraction method was carried out. The 18 S ribosomal RNA gene was amplified using polymerase chain reaction (PCR) and identified by Sanger sequencing on an Applied Biosystems (ABI) 3730 XL DNA Analyzer. No contamination was found in the sequencing results of the 18 S ribosomal RNA gene.
Roche 454 shotgun libraries and 8-kb and 20-kb span paired-end libraries were prepared based on Roche 454 manual and sequenced on Roche GS FLX titanium platform at University of Hawaii. Illumina 500 bp paired-end library was prepared based on Illumina manual and sequenced on Illumina Hiseq 2000 platform at Yale Center for Genome Analysis (YCGA).
Roche 454 shotgun libraries and 8-kb and 20-kb span paired-end libraries were prepared based on Roche 454 manual and sequenced on Roche GS FLX titanium platform at University of Hawaii. Illumina 500 bp paired-end library was prepared based on Illumina manual and sequenced on Illumina Hiseq 2000 platform at Yale Center for Genome Analysis (YCGA).
9
Viral DNA Library Preparation for NGS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First, to prepare viral DNA libraries, approximately 50 ng of genomic DNA from each sample were separately fragmented using the Roche Titanium-compatible Nextera DNA Sample Prep Kit (Epicentre Biotechnologies), according to the manufacturer’s protocol. In different reactions, viral DNA were MID-tagged (Roche 454 Life Sciences) during the Nextera amplification steps. The libraries were purified with Agencourt AMPure XP Beads (Beckman Coulter, Inc), at a 1:0.7 ratio (DNA:Beads) to eliminate fragments below 300 bp. The purified material was quantified and submitted to emPCR reactions, following the manufacturer’s instructions (emPCR Method Manual—Lib-L SV, Roche 454 Life Sciences). Finally, those pools were sequenced using a GS FLX Titanium platform (Roche 454 Life Sciences), in a single run, in accordance with manufacturer’s recommendations (Sequencing Method Manual, GS FLX Titanium Series, Roche 454 Life Sciences). The specific reads of each sample were segregated into 17 SFF files according to their MID tags, which were removed at this step.
10
Complete Genome Sequencing of Lactococcus lactis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA was extracted using the Genomic Maxi AX purification kit (A&A Biotechnology, Gdynia, Poland) preceded by incubation in TES-lysozyme (20 mg ml−1) for 30 min at 37 °C. The genome sequence of the L. lactis IBB477 strain was generated by shotgun and paired-end reads by using the GS FLX Titanium platform (F. Hoffmann-La Roche AG, Basel, Switzerland) and the Illumina sequencing technology. Sequence assembly was carried out using the Newbler Assembler version 2.4 software (F. Hoffmann-La Roche AG, Basel, Switzerland). The chromosome assembly was validated with MapSolver based on the optical map produced via OpGen’s Optical Mapping System for the whole genome of the IBB477 strain by using the restriction enzyme AflII. Gap resolution within plasmids was performed by PCR and sequencing using sequence-specific primers. Automatic annotation of the genome was generated using the National Center for Biotechnology Information (NCBI) Prokaryotic Genome Annotation Pipeline (PGAP; http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ ) version 2.0, released in May 2013, using the protein homology and GeneMarkS+ prediction program.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!