Wizard sv pcr clean up system

Gene disruptions were accomplished in T. brucei Cas9-expressing SmOx P9 procyclic forms by replacing both alleles of the target gene with antibiotic resistance genes using the CRISPR/Cas9 technique as described previously^{66 (link)}. Geneticin and hygromycin replacement cassettes, flanked by 30 bp sequences homologous to the target gene UTRs, were PCR-amplified from pPOTv7 plasmids using gene-specific forward and reverse primers (Table S6). Short guide RNA (sgRNA) templates, consisting of a T7 RNA polymerase promoter sequence and a gene-specific sgRNA sequence to guide double-strand breaks to the UTRs of the target gene, were amplified by annealing gene-specific primers with the G00 sgRNA scaffold primer. All PCR products were purified using Promega Wizard SV PCR clean-up system before transfection. Gene-specific geneticin and hygromycin targeting fragments and 5′ and 3′ sgRNA templates were combined with 1 × TbBSF buffer (90 mM sodium phosphate, 5 mM potassium chloride, 0.15 mM calcium chloride, 50 mM HEPES, pH 7.3) in a total volume of 100 µl and transfected into 3 × 10⁷ SmOx p9 T. brucei cells by electroporation using the Amaxa Nucleofector 4D (Lonza), program FI-115. Clonal populations resistant to both hygromycin and geneticin were obtained by limiting dilution, and complete loss of the target gene was verified by diagnostic PCR reactions.

Ethidium bromide stained 1.0% agarose gel electrophoresis was performed to analyze PCR products. 1 kb plus ladder (Thermo Scientific Generular) was used to estimate the DNA fragment size. We obtained single sharp bands of expected amplicon size for all the five overlapping primers (see Supplementary Fig. S11). The Wizard® SV PCR Clean-Up System (Promega, USA) as per the manufacturer’s protocol was followed to excise and purify the DNA fragments. The details of targeted DNA nucleotide sequence were created using separate sequencing reactions for forward and reverse primers. The ABI Big-dye Terminator v3.1 chemistry performed the sequencing reaction and ABI Sequencer 3730XL sequenced the DNA fragments, at the School of Agricultural Biotechnology, Punjab Agricultural University, Ludhiana. Experiment was carried out in two replications to confirm the presence of single nucleotide polymorphism (SNPs).

Genomic DNA concentrations and purity ratios were determined using a NanoDrop One spectrophotometer. 100 ng of genomic DNA was used to perform PCR reactions using the SapphireAMP Fast PCR Master Mix (Takara). Primers 5’AGCTTTCGCTCAGCAAATGTC (forward) and 5’ GTGACTCTGCGACGTATTTAT (reverse) or 5’ GCGTGGATCAGGTGATCCAG (forward) and 5’ ATCTTAAGCCATCGTCAGTTG (reverse) amplified the Sce.white sequence in the DR-white assay using the Touchdown 30 protocol described previously [9 (link)]: 94°C, 2 min; [94°C, 30s; 66°C touchdown (-0.5°C per cycle), 30s; 72°C, 30s]16x; [94°C, 30s; 58°C, 30s; 72°C, 30s]20x; 72°C, 5 min. PCR products were run on a 1% agarose gel. Samples with visible amplicons were purified using Wizard SV PCR Clean-Up System (Promega) and eluted in 25 μL water. 40–100 ng of purified samples were sent for Sanger sequencing (Azenta) using sequencing primer 5’-GAGCCCACCTCCGGACTGGAC.

A verification step was done to determine the mtDNA inserts in the plastomes of P. dilatatum and P. fimbriatum. Primers that were specific to only the mtDNA inserts were created (Additional file 4: Table S3). Each of these primers was used in combination with a plastome-specific primer in PCR experiments following the general methods of Dhingra and Folta [52 (link)] with modifications based on Leseberg and Duvall [53 (link)] and Morris and Duvall [20 (link)]. PCR products were electrophoretically separated for product number and length verification (Additional file 5: Figure S1). The products were cleaned using the Wizard SV PCR Clean-up System (Promega, Madison, Wisconsin, USA), and sent for automated Sanger sequencing at ACGT Inc. (Wheeling, Illinois, USA). The Geneious Pro pairwise align feature was used to align the Sanger and Illumina sequence data for verification of the inserts.