Isolation and analysis of RNA were performed as previously performed in our lab [1 (link)]. Briefly, after isolation, RNA was quantified using a Nanodrop. Bio-Rad iTaq (Universal SYBR® Green One-Step Kit was used to amplify cDNA (Bio-Rad, Hercules, CA, USA). A Bio-Rad Single-Color Real-Time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA) was used for data analysis. The following primers were synthesized by Invitrogen Life Technologies (Grand Island, NY, USA): AXL (For-CTAC GAG ACG TCA TGG TAG and Rev-GCT CTG ATC TTG TGC AGA TG), and β-actin (For-ACA GGA TGC AGA AGG AGA TTA C and Rev- CAC AGA GTA CTT GCG CTC AGG A).
Single color real time pcr detection system
Manufactured by Bio-Rad
Sourced in United States
The Single-Color Real-Time PCR Detection System is a laboratory instrument that enables real-time polymerase chain reaction (PCR) analysis using a single fluorescent dye. It is designed to detect and quantify specific nucleic acid sequences in samples.
Automatically generated - may contain errors
Lab products found in correlation
Iq sybr green supermix, by Bio-Rad (10 mentions)
Iscript cdna synthesis kit, by Bio-Rad (3 mentions)
Rneasy minelute cleanup kit, by Qiagen (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Itaq universal sybr green one step kit, by Bio-Rad (1 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Il 1β, by Thermo Fisher Scientific (1 mentions)
Tnf α, by Thermo Fisher Scientific (1 mentions)
Invitrogen superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Mito dna extraction kit, by Genmed Scientifics (1 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Beadarray reader, by Illumina (1 mentions)
Human ht 12 expression beadchips, by Illumina (1 mentions)
Quantitect sybr green pcr kit, by Qiagen (1 mentions)
Sypro orange, by Thermo Fisher Scientific (1 mentions)
17 protocols using single color real time pcr detection system
1
Quantitative RNA Analysis Protocol
2
Quantification of Cldn6 mRNA Expression in Mouse Lungs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microarray experiments were designed and mRNA analysis was conducted as already described [21 (link)]. In order to specifically assess Cldn6 mRNA expression throughout development, total RNA was isolated from whole mouse lungs at various time points with an Absolutely RNA RT-PCR Miniprep Kit (Stratagene, La Jolla, CA) and treated with DNase. Reverse transcription of RNA was performed using the Invitrogen Superscript III First-Strand Synthesis System (Life Technologies, Grand Island, NY) in order to obtain cDNA for PCR. The following primers were synthesized and HPLC purified by Invitrogen Life Technologies: Cldn6 (For-GCA GTC TCT TTT GCA GGC TC and Rev-CCC AAG ATT TGC AGA CCA GT) and GAPDH (For-TAT GTC GTG GAG TCT ACT GGT and Rev-GAG TTG TCA TAT TTC TCG TGG). cDNA amplification and data analysis were performed using Bio Rad iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA) and a Bio Rad Single Color Real Time PCR detection system (Bio-Rad Laboratories). Primers were used at a concentration of 75 nM each in 25-μl reactions. Cycle parameters were as follows: 3 min at 95°C for initial denaturation, followed by 40 cycles composed of 1 min at 95°C, 15 sec at 55°C and 15 s at 72°C. Control wells lacking template or RT were included to identify primer-dimer products and to exclude possible contaminants.
3
Mouse Lung RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from mouse lungs using an RT-PCR Miniprep Kit (Stratagene, La Jolla, CA, USA). Reverse transcription of RNA in order to obtain cDNA for qRT-PCR and cDNA amplification was performed using Bio Rad iTaq Universal SYBR® Green One-Step Kit (Bio-Rad Laboratories, Hercules, CA, USA). Data analysis was performed using a Bio Rad Single Color Real Time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA) [2 (link)]. The following primers were synthesized by Invitrogen Life Technologies (Grand Island, NY, USA): IL-1β (For-TGT AAT GAA AGA CGG CAC ACC and Rev-TCT TCT TTG GGT ATT GCT TGG), TNF-α (For-TGC CTA TGT CTC AGC CTC TTC and Rev-GAG GCC ATT TGG GAA CTT CT), Cldn6 (For-CAT TAC ATG GCC TGC TAT TC and Rev-CAC ATA ATT CTT GGT GGG ATA TT), and β-actin (For-ACA GGA TGC AGA AGG AGA TTA C and Rev-CAC AGA GTA CTT GCG CTC AGG A).
4
Quantifying Lung Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from mouse lungs using an RT-PCR Miniprep Kit (Stratagene, La Jolla, CA). Reverse transcription of RNA was performed using the Invitrogen Superscript III First-Strand Synthesis System (Life Technologies, Grand Island, NY) in order to obtain cDNA for qRT-PCR. The following primers were synthesized by Invitrogen Life Technologies (Grand Island, NY): Cldn6 (For-GCA GTC TCT TTT GCA GGC TC and Rev-CCC AAG ATT TGC AGA CCA GT) and GAPDH (For-TAT GTC GTG GAG TCT ACT GGT and Rev-GAG TTG TCA TAT TTC TCG TGG). The cDNA amplification and data analysis were performed using Bio Rad iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA) and a Bio Rad Single Color Real Time PCR detection system (Bio-Rad Laboratories) (Robinson et al., 2012) .
5
Quantitative Real-Time PCR for mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time RT–PCR was performed with the Single-Color Real-Time PCR Detection System (BioRad, Munich, Germany) using primer pairs described in Table 1 . The PCR solution contained 1 µl of cDNA, a specific primer set (0.2 µM each), and 10 µl of a 2× mastermix (iQ SYBR Green Supermix, BioRad) in a final volume of 20 µl. The following conditions were used: initial denaturation and enzyme activation (one cycle at 95 °C for 3 min); denaturation, amplification, and quantification (45 cycles at 95 °C for 30 s, 58 °C for 20 s, and 72 °C for 45 s); and a melting curve (55 °C, with the temperature gradually increased 0.5 °C up to 95 °C). The amplified samples were analyzed by standard agarose gel electrophoresis. mRNA expression was normalized to the level of β-actin mRNA. Changes in mRNA expression were calculated according to the 2-ΔΔCT method (CT, cycle threshold), with ΔCT=CTtarget gene - CTactb and ΔΔCT=ΔCTtreatment - ΔCTcontrol.
6
Quantification of Mitochondrial DNA Copy Number
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantification of mtDNA copy number was performed by real-time PCR. mtDNA was isolated from gastrocnemius muscle tissues and L6 cells using a Mito DNA Extraction Kit (Genmed Scientifics Inc., USA). DNA was quantified spectrophotometrically (260 nm) and subjected to quantitative real-time PCR (100 ng/reaction; SYBR Green I fluorescent RT-PCR protocol, PE Biosystems) in a single color real-time PCR detection system (BIO-RAD, USA). Relative amounts of mtDNA were determined by comparing their amplification products to those of β-actin (forward: 5'-CCACCATGTACCCAGGCATT-3' ; reverse: 5'-CGGACTCATCGTACTCCTGC-3' ) and cytochrome b (forward: 5'- AACGCCAACCCTAGACAACC -3' ; reverse: 5'- GAGATGTTAGATGGGGCGGG -3' ).
7
Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time reverse transcriptase (RT)-PCR was performed with the Single-Color Real-Time PCR Detection System (BioRad, Munich, Germany) using the primer pairs described in Table 1 . The PCR solution contained 1 µl of cDNA, the specific primer set (0.2 µM each), and 7.5 µl of a 2× mastermix (iQ SYBR Green Supermix; BioRad) in a final volume of 15 µl. The following conditions were used: initial denaturation and enzyme activation (one cycle at 95 °C for 3 min); denaturation, amplification, and quantification, 45 cycles at 95 °C for 30 s, 58 °C for 20 s, and 72 °C for 45 s; and melting curve, 55 °C with the temperature gradually (0.5 °C) increased up to 95 °C. The amplified samples were analyzed using standard agarose gel electrophoresis. The mRNA expression was normalized to the level of β-actin mRNA. The changes in mRNA expression were calculated according to the 2-ΔΔCT method (cycle threshold, CT), with ΔCT = CTtarget gene – CTactb and ΔΔCT = ΔCTtreatment – ΔCTcontrol.
8
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific/Invitrogen, 15596026) according to the manufacturer’s instructions and extracted with RNeasy Min Elute Clean up kit (QIAGEN, 154015861,). Reverse transcription reaction was performed using iScript cDNA synthesis kit (Bio-Rad, 170–8891) with 0.5 µg of total RNA as input. The mRNA expression levels were determined by quantitative real-time PCR using iQSYBR Green Supermix (Bio-Rad, 170–8882) and Single color Real-Time PCR Detection System (Bio-Rad, U.S) as previously described [39 ]. The following primers were used to detect the expression level of tbp (TATA-box binding protein; reference gene), forward: CCTGCCCATTTCAGTC and reverse: TGTTGTTGCCTCTGTTGCTC; il1b (interleukin 1b), forward: TGTGTGTTTGGGAATCTCCA and reverse: TGATAAACCAACCGGGACA; tnfa (tumor necrosis factor a), forward: CAAAGACACCTGGCTGTAGAC and reverse: AGACCTTAGACGAGAGATGAC; mmp9 (matrix metallopeptidase 9), forward: CATTAAAGATGCCCTGATGTATCCC and reverse: AGTGGTGGTCCGTGGTTGAG.
9
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol reagent (15596026, Invitrogen) according to the manufacturer’s instructions and purified with RNeasy Min Elute Clean up kit (Lot:154015861, QIAGEN). RNAs were quantified using a NanoDrop 2000c instrument (Thermo Scientific, U.S). Reverse transcription reaction was performed using 0.5 μg of total RNA with iScript cDNA synthesis kit (Cat:#170–8891, Bio-Rad). The mRNA expression level was determined by quantitative real-time PCR using iQSYBR Green Supermix (Cat:170–8882, Rio-Rad) and Single color Real-Time PCR Detection System (Bio-Rad, U.S) as previously described [61 (link)]. All primers are listed in S5 Table .
10
Real-Time RT-PCR Quantification of mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time RT–PCR was performed with the Single-Color Real-Time PCR Detection System (Bio-Rad, Munich, Germany) using the primer pairs described in Table 1 . The PCR solution contained 1 µl cDNA, a specific primer set (0.2 µM each), and 7.5 µl of a 2X mastermix (iQ SYBR Green Supermix; Bio-Rad) in a final volume of 15 µl. The following conditions were used: initial denaturation and enzyme activation (one cycle at 95 °C for 3 min); denaturation, amplification, and quantification, 45 cycles at 95 °C for 30 s, 58 °C for 20 s, and 72 °C for 45 s; melting curve, 55 °C with the temperature gradually (0.5 °C) increased up to 95 °C. The amplified samples were analyzed with standard agarose gel electrophoresis. mRNA expression was normalized to the level of β-actin (ACTB, Gene ID: 60; OMIM: 102630 ) mRNA. The changes in mRNA expression were calculated according to the 2-ΔΔCT method [48 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!