Lightcyclerr 480 real time pcr system

Total RNA was isolated from different tissues of rice plants using a RNeasy plant mini kit (Qiagen, Seoul, Korea, www.qiagen.com) respectively, and single-strand cDNA was synthesized with random oligonucleotides using a reverse transcription system (Bioneer, www.bioneer.co.kr, E-3122 (M-MLV Reverse Transcriptase) based on a previously reported method [18 (link)]. Primers used in the experiment are listed in Supplementary Table S1. qRT-PCR analysis was performed according to the manufacturer’s instructions using LightCyclerR 480 Real Time PCR system (Roche, CA, United States). “Relative expression” levels were calculated using the 2^−ΔΔCT method, and OsActin (Q10DV7) was used as a reference gene in rice. All experiments included three biological replicates, each with two technical replicates.

RNA extractions from 5 × 10⁵-2 × 10⁶ cells were performed with Quick RNA Miniprep Kit (Zymo Research). DNAse treatment was performed on-column as indicated. 150 ng-1ug RNA were retrotranscribed with Reverse Aid reverse transcriptase (Life Technologies). In all cases, a control reaction was prepared without RTase (“no RT”) in order to detect genomic DNA contamination. Quantitative PCR (qPCR) was performed with SYBR Green master mix (Roche) and in LightCycler^R480 Real-Time PCR System (Roche). Primer sequences can be found in Additional file 6: Table S7 and S8. All quantifications were normalized to an endogenous control (Hipoxanthine-guanine phosphoribosyl transferase, HPRT; or Glyderaldehyde 3-phosphate dehydrogenase, GAPDH). The relative quantification value for each target gene compared with the calibrator is expressed as 2^(Ct-Cc). Products from the qPCRs were loaded in 2 % agarose gels to check for correct size.

We then selected the following markers for RT-PCR confirmation of mRNA expression levels: IL1R1, TLR2, TLR4, IL1T2, ARG1, and TLR5. All mRNA samples were first transformed into cDNA according to manufacturer instructions (cDNA-High Capacity cDNA Reverse Transcription kit, Applied Biosystems, Cat. 4368813). Samples were then prepared by adding 2.5 ng/μL of cDNA with 0.2 μL each of forward and reverse primers (10 μM) and 5 μL of SYBR Green PCR Master Mix (ABI, Cat. 4367659) before performing quantitative RT-PCR on the LightCycler R 480 Real-Time PCR System (Roche Molecular Systems, Inc. Indiana, USA). 18S was used as an internal control. IL1R1—Forward (F) AAAGATGACAGCAAGACACCTG, Reverse (R):GTTTGCAATCCTTACCACGCAA; TLR2—(F): GAGTTCTCCCAGTGTTTGGTGT (R):CACACCATCAGAACCCTGTC; IL1R2—(F):ATGACACCCACATAGAGAGCG (R):GAAGAGCGAAACCCACAGAGT; ARG1—(F):ACTTAAAGAACAAGAGTGTGATGTG (R) CGCTTGCTTTTCCCACAGAC; TLR5—(F):TGCTACTGACAACGTGGCTT (R):CCAGGAAAGCTGGGCAACTA; TLR4—(F):ATGCCAGGATGATGTCTGCC (R):TGGATTTCACACCTCCACGC; 18S—(F):GTAACCCGTTGAACCCCATT (R):CCATCCAATCGGTAGTAGCG. We then calculated the relative quantification of mRNA expression levels by using the comparative threshold cycle (CT) method (i.e., by comparing the RT-PCR cycle number required to reach target fluorescence) by using the following equation: 2^{−(ΔCTtarget−ΔCTcalibrator)}, also known as 2^−ΔΔCT.

Total RNA was isolated using the miRNeasy Micro Kit (QIAGEN, Hilden, Germany), as explained in Phowira et al., 2022 [8 (link)].
Reverse transcription was performed using the miRCURY LNA RT Kit (QIAGEN, Hilden, Germany) on about 10 μL of RNA. Following the methodology for miRCURY LNA miRNA PCR, cDNA was diluted 100× and assessed in 10 μL PCR reactions. The miRNA was assayed once by qPCR using the miRCURY LNA SYBR Green master mix on the miRNA Ready-to-Use PCR, Human panel I + II (Catalog number: 339322, QIAGEN). The amplification was carried out using a LightCyclerR 480 Real-Time PCR System (Roche, Basel, Switzerland) and data were analyzed using Roche LC software 4 (Basel, Switzerland). The ΔCq values were obtained by using the global mean normalization approach to correct all Cq data. Fold-change analysis was performed using 2 × |ΔΔCq| calculation, with ΔΔCq obtained from (∆Cq × T1DM) − (∆Cq × HCs).

To validate the expression of the ceRNA regulatory network, the DE-lncRNAs, and their target mRNAs, RT–qPCR validation was performed using SYBR Green assay reagents and a LightCycler^R 480 RealTime PCR System (Roche, USA) as described by Zhou et al. (2012) (link). Total and small RNAs were extracted using the same samples used for RNA-sequencing. For small RNA reverse transcription, universal primers (Supplementary Table S1) in the Mir-X miRNA First-Strand Synthesis (Clontech Laboratories, CA, USA) were used for reverse transcription. Mature miRNA sequences and universal primers (Supplementary Table S1) were used for RT–qPCR according to the manufacturer’s instructions for the SYBR qRT-PCR kit (Clontech Laboratories, CA, USA). For RNA reverse transcription, 2 μg of total RNA was reverse-transcribed using the PrimeScript™ RT Reagent Kit (TaKaRa BIO, Japan). The specific primers of the tested genes are shown in Supplementary Table S1. Each DE-lncRNA, DE-miRNA, and DE-mRNA was analyzed in three replicates. Relative expression levels were calculated using the 2^–ΔΔCt method. Actin was used as the endogenous reference genes for DE-lncRNAs and DE-mRNAs, and 5.8S rRNA was used as the endogenous reference gene for DE-miRNAs (Supplementary Table S1).

Genomic DNA of poplar roots was extracted using cetyltrimethylammonium bromide (CTAB). Total RNA was isolated and extracted using a total RNA extraction kit [TRK1001, Lianchuan (LC) Science, Hangzhou, China]. Simultaneously, DNA and ribosomal RNA were removed from total RNA using RNase-free DNase I (E1091, Omega Bio-Tek, Norcross, GA, United States) and ribosomal RNA removal kits (MRZPL116, Illumina, CA, United States), respectively. The RNA was then reverse transcribed using a PrimeScript RT reagent kit (Takara, Dalian, China) according to the manufacturer’s instructions. To confirm that the circRNAs sequenced in poplar roots were actual circRNAs, we used convergent primers (positive control) and divergent primers for PCR (Supplementary Table 1). The PCR products were verified by electrophoresis and sequenced.
To verify the expression of DECs and DE-mRNAs in poplar roots treated with three N forms, RT–qPCR was performed on a Light Cycler^R 480 Real Time PCR System (Roche, United States) using the SYBR Green PCR kit (TaKaRa) as described by Zhou et al. (2020) (link). The relative expression levels were determined by the 2^–ΔΔCt method. The Actin gene was used as an endogenous reference gene for circRNAs and targets. All experiments were repeated three times. Specific primer sequences for the amplification of circRNAs and mRNAs are listed in Supplementary Table 1.