Power masher

Specimens were homogenized using a Power Masher (Nippi Inc.) with BioMasher II (Nippi Inc.) in QIAzol Lysis Reagent (Qiagen). Total RNA was extracted using the miRNeasy Mini Kit (Qiagen). Quantity and purity (A260/280 ratio, A260/A230 ratio) of the extracted RNA were measured using a NanoDrop1000 spectrometer (NanoDrop Technologies). Quality check of extracted RNA was performed by measuring RNA Integrity Number and the 28S/18S rRNA ratio using an Agilent 2100 BioAnalyzer (Agilent Technologies).

The kidney samples from each group (control, diabetes, diabetes on imidapril, and diabetes on imidapril with AcSDKP) that had been maintained at −70°C were first incubated in RNAlater^R-ICE (Life Technologies) for 16 h at −20°C before homogenization to allow us to extract high-quality miR. Subsequently, tissues were homogenized on ice using a Power Masher (Nippi, Tokyo, Japan). The miRs were extracted using a miRNeasy Mini kit (Qiagen) according to the manufacturer's instructions. Complementary DNA (cDNA) was generated by a miScript II RT kit (Qiagen) using the hiSpec buffer method. miR expression was quantified using a miScript SYBR Green PCR Kit (Qiagen), with 3 ng of complementary DNA. The primers for quantifying Mm_miR-29a, Mm_miR-29b, and Mm_miR-29c were miScript primer assays predesigned by Qiagen. The mature miR sequences were 5′ UAGCACCAUCUGAAAUCGGUUA for Mm_miR-29a, 5′ UAGCACCAUUUGAAAUCAGUGUU for Mm_miR-29b, and 5′ UAGCACCAUUUGAAAUCGGUUA for Mm_miR-29c. All experiments were performed in triplicate, and Hs_RNU6-2_1 (Qiagen) was utilized as an internal control. The primers to quantify Mm_miR-let7b-1, Mm_miR-let7c, and Mm_miR-let7f were designed by Qiagen. The mature sequences were UGGAAGACUUGUGAUUUUGUUGU for Mm_miR-let7b-1, CUGUACAACCUUCUAGCUUUCC for Mm_miR-let7c, and CUAUACAAUCUAUUGCCUUCCC for Mm_miR-let7f, respectively.

Blood collected from the mice was centrifuged (3,000 rpm, 4°C, 20 min) to prepare serum samples. The hypothalamus and liver were homogenized using a Power Masher (Nippi Inc., Tokyo, Japan) with BioMasher (Nippi Inc.) in a lysis buffer containing 20 mM Tris (pH 7.4), 150 mM NaCl, 2 mM EDTA, 1% (v/v) Nonidet P-40, 0.1% (w/v) SDS, and protease inhibitor cocktail diluted 1∶100 (Sigma-Aldrich Inc., St. Luis, MO, USA). After centrifugation (12,000×g, 4°C, 10 min), the total protein in supernatant was measured using a reducing agent- and detergent-compatible (RC DC) protein assay reagent (Bio-Rad Laboratories Inc., Hercules, CA, USA) [11] , and total protein concentrations of supernatant then diluted with lysis buffer to achieve 3 mg/mL concentrations. The level of adiponectin, SAA, IL-6, and CGRP proteins in all the samples were determined using the Mouse/Rat Adiponectin ELISA kit (Otsuka Pharm Co., Tokyo, Japan), PHASE™ RANGE Mouse SAA ELISA kit (Tri-Delta Diagnostics Inc., Morris Plains, NJ, USA), Mouse IL-6 ELISA Ready-SET-Go! kit (eBioscience Inc., San Diego, CA, USA), and CGRP ELISA kit (USCN Life Science Inc., Huston, TX, USA), respectively, according to the manufacturer's instructions.

Dissected cerebral cortices (Fig. 2) from 6-week-old male offspring (n = 5/group) were homogenized using the Biomasher II and Powermasher (Nippi Inc., Tokyo, Japan) in T-PER Tissue Protein Extraction Reagent (20 mL/g of tissue) (Takara Bio. Inc., Shiga, Japan) containing protease inhibitor cocktail (Complete tablet, EDTA-free, Roche Diagnostics, Basel, Switzerland) at 4 °C. Homogenates were centrifuged at 10,000 × g for 5 min at 4 °C to remove insoluble debris and then supernatants were collected for analysis. Supernatant total protein concentrations were determined by the bicinchoninic acid method using the Pierce BCA Protein Assay kit (Thermo Fisher Scientific K.K., MA, USA). Extracts were then stored at −80 °C until use.Fig. 2

Collected/analyzed areas of the cerebral cortex in offspring mice (red zone)