Primescript rt reagent kits with gdna eraser

Quantitative real-time PCR (qRT-PCR) was used to verify the transcript levels of the RNA-Seq results. Total RNA was extracted using the TRIzol kit (Invitrogen, Waltham, MA, USA), according to the manufacturer’s instructions. Then, the cDNA was synthesized by reverse transcription using PrimeScript RT reagent kits with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instructions. Sixteen gene-specific primers for qRT-PCR were designed based on reference unigene sequences randomly chosen from the DEGs using Primer Premier 5.0. Real-time PCR was conducted using SsoAdvancedTM Universal SYBR Green Supermix (Hercules, CA, USA) according to our earlier research [32 (link)]. The 2-ΔΔCt algorithm was used to calculate the relative level of gene expression. The β-actin gene was used as the internal control, and the WT samples served as the control. All qRT-PCR were performed with three biological replicates, and run on a Bio-Rad CFX96 Real-Time System (Bio-Rad, Hercules, CA, USA).

Plasma cells were purified from bone marrow mononuclear cells with anti-CD138 antibody conjugated with phycoerythrin (PE) (Beckman Coulter, Brea, CA, USA) and the Easy Step PE positive selection kits containing anti-PE antibodies conjugated with micro-magnetic beads (STEMCELL Technologies, Vancouver, BC, Canada). RNA was extracted from the plasma cells (and one autopsied extramedullary plasmacytoma of the liver) and cell lines using mirVana RNA Isolation kits (Ambion, Austin, TX, USA). Complimentary DNA (cDNA) was produced using PrimeScript™ RT reagent kits with gDNA Eraser (TaKaRa Bio, Kyoto, Japan).

Total RNA was extracted from 43 pairs of fresh clinical lung tumor tissues with matched adjacent normal lung tissues using TRIzol reagent (ThermoFisher Scientific, Waltham, MA, USA). RNA in the aqueous phase was precipitated using trichloromethane, isopropanol, and 70% ethanol. Reverse transcription was performed using PrimeScriptRT Reagent Kits with gDNA Eraser (Takara Bio, Beijing, China). qRT-PCR was performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using SYBR Green PCR Master Mix (Takara Bio) in 20 μl final volume with the following thermocycling conditions: 95 °C for 30 s, followed by 45 cycles at 95 °C for 5 s, then 60 °C for 30 s. A melting curve was generated to confirm the specificity of amplification. Relative gene expression was calculated using the 2^−ΔΔCt method with ACTB as the internal control. The primer sequences used were as follows: KLHL38 (forward) 5′–GGCCCTCATGGTTTGGATCA–3′ and (reverse) 5′–ATCGTTGGCGATGAAGTGGT–3′; ACTB (forward) 5′–ATAGCACAGCCTGGATAGCAACGTAC–3′ and (reverse) 5′–CACCTTCTACAATGAGCTGCGTGTG–3′; PTEN (forward) 5′–CCCAGTTTGTGGTCTGCCAGC–3′ and (reverse) 5′–ATGAGCTTGTCCTCCCGCCG–3′. Dissolution curves ensured the validity of amplification. All experiments were performed in triplicate.

Total RNA was extracted from frozen tissue of PTCLs and reactive hyperplasia, as well as bone marrow blasts of T-ALL, using TRIzol reagent (Invitrogen). cDNA was synthesized using PrimeScript RT reagent Kits with gDNA Eraser (TaKaRa, CA, USA) following the manufacturer’s instructions. Real-time polymerase chain reaction (PCR) was performed using SYBR Premix Ex Taq™ II (TaKaRa) on ABI Prism 7500 (Applied Biosystems, Bedford, MA, USA). The relative gene expression levels were calculated using the SDS2.4 software. The primer sequences were as follows: c-FLIP_L forward, 5′-ATTGCATTGGCAATGAGACAGAGC-3′; reverse, 5′-TCGGTGCTCGGGCATACAGG-3′, c-FLIP_S forward, 5′-ACCCTCACCTTGTTTCGGACTAT-3′; reverse, 5′-TGAGGACACATCAGATTTATCCAAA-3′, TRAIL forward, 5′-TCAGCACTTCAGGATGATGG-3′; reverse, 5′-CACCAGCTGTTTGGTTCTCA-3′, DR5 forward, 5′-TGACGGGGAAGAGGAACTGA-3′; reverse, 5′-GGCTTTGACCATTTGGATTTGA-3′, GAPDH forward, 5′-GAAGGTGAAGGTCGGAGTC-3′; reverse, 5′-GAAGATGGTGATGGGATTTC-3′.
Real-time PCR of NF-κB signaling pathway was performed using the RT² profiler PCR Array-Human NF-κB signaling pathway (QIAGEN Sciences, Frederick, MD, USA). GAPDH was used as the endogenous control and Jurkat cells for calibration. A relative quantification was calculated using the ^ΔΔCT method.