The largest database of trusted experimental protocols

Chip enzymatic chromatin ip kit

Manufactured by Cell Signaling Technology
Sourced in United States

The ChIP Enzymatic Chromatin IP Kit is a laboratory equipment product that enables the extraction and purification of chromatin fragments from cells or tissues for use in chromatin immunoprecipitation (ChIP) experiments. The kit provides the necessary reagents and protocols to effectively shear chromatin using enzymatic digestion, allowing for the isolation of protein-DNA complexes.

Automatically generated - may contain errors

14 protocols using chip enzymatic chromatin ip kit

1

Identifying CEBPD-binding Sites in DSG2

Check if the same lab product or an alternative is used in the 5 most similar protocols
The responsive CEBPD‐binding sites in the DSG2 gene upstream promotor were determined by the chromatin immunoprecipitation (ChIP) Enzymatic Chromatin IP Kit (Cell Signaling Technology, Danvers, MA, USA). For details of the experiment, please refer to online Additional Materials and Methods.
+ Open protocol
+ Expand
2

ChIP Assay to Investigate KLF13 Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
To investigate whether KLF13 binds to the promoter of the ACOT7 gene, a ChIP assay was conducted in Flag-KLF13-overexpressing HepG2 and Huh7 cells using a simple ChIP enzymatic chromatin IP kit (Cell Signaling) according to the manufacturer’s protocols. The qPCR was utilized to verify the presence of a KLF13-binding region in the ACOT7 promoter. The following qPCR primer sequences were used: forward, 5ʹ GAAGGCAGCTAAGGCCCTG −3ʹ and reverse, 5ʹ-GAGAGTCGTGGGCGGAAC −3ʹ. The antibodies included anti-normal rabbit IgG (Cell Signaling Technology, #2729) and anti-Flag (Cell Signaling Technology, #14793).
+ Open protocol
+ Expand
3

Revealing FXR Regulation of NLRP3 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
We conducted a ChIP assay in Flag-FXR-overexpressing LX2 cells using a simple ChIP enzymatic chromatin IP kit (Cell Signaling) according to the manufacturer’s protocol. qPCR was utilized to verify the presence of FXR-binding region in the NLRP3 promoter. The following qPCR primer sequences were used: (1) forward, 5ʹ-TGGGATTACAGGCGTGAG − 3ʹ and reverse, 5ʹ-CTGGGTGACAAGAGCAAGAC − 3ʹ; (2) forward, 5ʹ-TGAGTCAATGAGTCAGGGAG − 3ʹ and reverse, 5ʹ- GAGGGAAGTGAAACTAAGGA − 3ʹ. The antibodies included anti-normal rabbit IgG (Cell Signaling Technology, #2729) and anti-Flag (Cell Signaling Technology, #14793).
+ Open protocol
+ Expand
4

ChIP Assay of Liver Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
A ChIP assay of liver lysates was conducted using the ChIP Enzymatic Chromatin IP Kit (#9003, Cell Signaling Technology). Liver tissues from mice fed a KD after adenovirus injection were lysed and cross-linked by incubating cells in 1% formaldehyde for 15 min at room temperature. Cross-linking was stopped by 5 min of incubation with 125 mM glycine. Chromatin was immunoprecipitated overnight at 4 °C with antibodies against NCoR1 or nonspecific IgG (Cell Signaling Technology). Data were normalized to input quantity. All primer sequences are listed in Supplementary Table 4.
+ Open protocol
+ Expand
5

Chromatin Immunoprecipitation Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatin immunoprecipitation (ChIP) assay was performed using ChIP Enzymatic Chromatin IP Kit (Magnetic beads, Cell Signaling, Danvers, MA) according to the manufacturer’s instructions. Briefly, the cells were crosslinked with formaldehyde of 1% final concentration first. Then, they were washed with pre-cold PBS and collected, followed by sonication crush. The solution complexes were immunoprecipitated using the anti-PPARG2 antibody (1 : 100; catalog number sc-166731, Santa Cruz, CA) or rabbit immunoglobulin G (IgG, negative control). After that, the immunoprecipitated complexes were collected using protein G-agarose beads. The precipitates were eluted from the beads and the DNA–protein complexes were de-crosslinked at last. The DNA samples were recollected and used for PCR analysis. The PCR conditions were as follows: the holding stage keeps 95 °C for 5 min (1 cycle), the cycling stage holds 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s (35 cycles), and 72 °C for 10 min (1 cycle). ChIP primers for detailed sequences were shown in Supplementary Table S1.
+ Open protocol
+ Expand
6

Simple Chromatin Immunoprecipitation (ChIP) Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Simple chromatin immunoprecipitation (ChIP) Enzymatic Chromatin IP Kit (Cell Signaling Technology, Danvers, MA, USA) was used for ChIP assays according to the manufacturer's protocol. Briefly, cells were crosslinked with 1% formaldehyde and collected in lysis buffer. Chromatin was then digested with micrococcal nuclease. Immunoprecipitation was incubated with 3 μg of anti-INSM1 antibody or normal rabbit IgG followed by immunoprecipitation with protein G agarose beads during an overnight incubation at 4°C with gentle shaking. As an input reference, 2% of the volume was removed before incubation with the antibody and stored at −20°C. The ChIP DNA was reverse crosslinked with 5 mol/L NaCl and Proteinase K and then purified. Immunoprecipitated DNA was amplified by PCR using primers, which are listed in Supplementary Table 3.
+ Open protocol
+ Expand
7

ChIP Assay of Liver Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
A ChIP assay of liver lysates was conducted using the ChIP Enzymatic Chromatin IP Kit (#9003, Cell Signaling Technology). Liver tissues from mice fed a KD after adenovirus injection were lysed and cross-linked by incubating cells in 1% formaldehyde for 15 min at room temperature. Cross-linking was stopped by 5 min of incubation with 125 mM glycine. Chromatin was immunoprecipitated overnight at 4 °C with antibodies against NCoR1 or nonspecific IgG (Cell Signaling Technology). Data were normalized to input quantity. All primer sequences are listed in Supplementary Table 4.
+ Open protocol
+ Expand
8

Hoxa13 Chromatin Immunoprecipitation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
According to the manufacturer’s instructions, simple ChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, Danvers, MA, USA) was applied to ChIP assays. Briefly, cells were crosslinked with EBM-2 containing 1% formaldehyde and collected in lysis buffer. And then micrococcal nuclease was used to digest the chromatids. Immunoprecipitation was incubated with 3 mg of anti-Hoxa13 antibody (1:1000, ABcam, UK) or normal rabbit IgG followed by immunoprecipitating with Protein G Agarose Beads and stored at 4 ℃ overnight with gentle shaking. Then the DNA crosslink was reversed by 5 mol/l NaCl and Proteinase K. Finally, DNA was purified. Immunoprecipitated DNAs were amplified by PCR according to their specific primers as follows:
Control PCR1: forward 5′-TGAAAATGTGGACTAGAGCCAGA-3′;
reverse 5′-CAGACACTCCAGAACAGGGC-3′;
AGGF1PCR2: forward 5′-TCCCCGCATCCATCCTCTTA-3′;
reverse 5′-CCCATTCCCACTTCCTCCAC-3′.
+ Open protocol
+ Expand
9

Chromatin Immunoprecipitation for BDNF Promoters

Check if the same lab product or an alternative is used in the 5 most similar protocols
The simple ChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology) was used following the manufacturer’s instruction. In brief, primary antibodies (histone deacetylase 4 [HDAC4], HDAC6, or IgG antibody as a control) were coated to get immunoprecipitated DNA, which was subjected to real-time PCR (RT-PCR) using specific BDNF promoters primers (PI, PII, PIII, PIV, and PIX) (Supplementary Table S1). Then the cumulative fluorescence for each amplification was normalized to the input DNA.
+ Open protocol
+ Expand
10

ChIP Assay of Liver Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
A ChIP assay of liver lysates was conducted using the ChIP Enzymatic Chromatin IP Kit (#9003, Cell Signaling Technology). Liver tissues from mice fed a KD after adenovirus injection were lysed and cross-linked by incubating cells in 1% formaldehyde for 15 min at room temperature. Cross-linking was stopped by 5 min of incubation with 125 mM glycine. Chromatin was immunoprecipitated overnight at 4 °C with antibodies against NCoR1 or nonspecific IgG (Cell Signaling Technology). Data were normalized to input quantity. All primer sequences are listed in Supplementary Table 4.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!