SNs were homogenized, and total RNA was purified using the RNA Sample Preparation Kit (Veridex LLC, Huntingdon Valley, PA). Samples were analyzed using a prototype kit run on the Cepheid SmartCycler system (Cepheid, Sunnyvale, CA). This system has been shown to have clinical utility to finalize reverse transcription of the complementary DNA (cDNA) and amplification of the cDNA in one step within approximately 40 minutes, as previously described [25 (link)]. Moreover, this kit was designed to detect mRNA expressions of carcinoembryonic antigen (CEA), cytokeratin 19 (CK 19), and porphobilinogen deaminase as an internal control. The cutoff values of the threshold cycle (Ct) in CEA and CK 19 were set at 38 Ct and 37 Ct, respectively, as previously described [25 (link)].
Smart cycler system
Manufactured by Cepheid
Sourced in United States, Germany
The Smart Cycler System is a thermal cycler for DNA amplification and analysis. It is designed to perform automated PCR (Polymerase Chain Reaction) and real-time PCR assays. The system provides precise temperature control and monitoring capabilities to facilitate the amplification of nucleic acid samples.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Geneohm c diff assay, by BD (2 mentions)
Qscript cdna supermix reagent, by Quanta Biosciences (2 mentions)
Rt2 real time sybr green reagents, by Qiagen (2 mentions)
One step sybr green master mix 2, by Takara Bio (2 mentions)
Sybr premix ex taq kit, by Takara Bio (2 mentions)
Superscript 3, by Thermo Fisher Scientific (2 mentions)
Biophotometer plus, by Eppendorf (2 mentions)
Sybr green 1, by Thermo Fisher Scientific (2 mentions)
Ex taq rt pcr version, by Takara Bio (2 mentions)
Rnase free dnase set, by Qiagen (2 mentions)
First strand cdna synthesis kit for rt pcr, by Roche (2 mentions)
Bact alert system, by bioMérieux (1 mentions)
Rnazol b, by Tel-Test (1 mentions)
Hiperfect transfection reagent, by Qiagen (1 mentions)
Superscript 3 first strand kit, by Thermo Fisher Scientific (1 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Icycler, by Bio-Rad (1 mentions)
Rnaqueous micro kit, by Thermo Fisher Scientific (1 mentions)
21 protocols using smart cycler system
1
One-Step RT-qPCR for CTC Detection
2
Multistep C. difficile Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The clinical microbiology laboratory tested stool samples for toxigenic C. difficile with a two-step algorithm. The initial step used the C. Diff Quik Check Complete test for C. difficile glutamate dehydrogenase (GDH) and toxin A or B by the use of an enzyme immunoassay (Techlab, Inc., Blacksburg, VA). All initial step results that were discordant (GDH positive and toxin negative [GDH+/toxin−] or GDH−/toxin+) were reanalyzed (reflexed) using a real-time PCR for the tcdB gene and the GeneOhm Cdiff assay (BD, Franklin Lakes, NJ) run on a Cepheid SmartCycler system (Cepheid, Sunnyvale, CA). Where available, PCR cycle threshold (CT) values were obtained through query of the SmartCycler database. Confirmation of positive tests was attempted by anaerobic culture on taurocholate-cycloserine-cefoxitin-fructose agar at 37°C, and isolates were ribotyped using a high-throughput, fluorescent PCR ribotyping protocol previously validated at multiple sites and described elsewhere (36 (link)).
3
Rapid Detection of Clostridium difficile Infection
4
Gene Expression Profiling of Chondrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from chondrocyte cultures with TRIzol reagent (Invitrogen), according to the manufacturer’s instructions. The RNA was reverse transcribed with qScript cDNA Supermix reagents (Quanta BioSciences, Gaithersburg, MD) and amplified at 42 °C for 30 minutes. For real-time reverse transcription–polymerase chain reaction (RT-PCR), the PCR products were detected using RT2 Real-Time SYBR Green reagents (SABiosciences, Frederick, MD). Primer-specific amplification was performed at 60 °C for 30 seconds. However, fluorescence quantification was performed at a higher temperature (72°C). The primers pair sequences for bovine genes, forward and reverse, are as follows; GAPDH, 5′-ATTCTGGCAAAGTGGACATCGTCG-3′, 5′-ATGGCC TTTCCATTGATGACGAGC-3′; ADAMTS4, 5′-TCACTG ACTTCCTAGACAATGG-3′, 5′-ACTGGCGGTCAGCGT CGTAGT-3′; ADAMTS5, 5′-CACCGTGGCTCACGAAA TTG-3′, 5′-GGAGCCGAAATTTTCTTCACAGA-3′. All primers were obtained from Integrated DNA Technologies (Coralville, IA). Thermal cycling and fluorescence detection were performed using the SmartCycler System (Cepheid). Real-time PCR efficiencies and the fold increase in copy numbers of messenger RNA (mRNA) were calculated as described previously.34 (link) The data are presented as mean ± standard deviation (SD) by setting negative control as 1.0, and analyzed by Student’s t test. P values <0.05 were considered significant.
5
Qualitative Detection of HCV Using RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real Time Polymerase Chain Reaction (RT-PCR) was carried out using a Sacace HCV Real-TM Qual kit for the qualitative detection of HCV in serologic specimens using the following procedure:
HCV RNA was extracted from sera following the manufacturer’s instructions (Sacace, REF K–2-C/100). RT-PCR was performed for each sample using a Cepheid Smart Cycler system and the detection was carried out using two reporter dyes monitored at two different wavelengths, one for HCV and the other for Internal Control (IC). Fluorescent intensities during RT-PCR were monitored to determine accumulated product and the cycle threshold (Ct) value, i.e. the number of PCR cycles required to exceed the IC fluorescence signal, was determined for each sample.
Samples yielding a Ct value lesser than 40 were considered positive for HCV-RNA, while those yielding a Ct value greater than 40 were considered PCR negative.
HCV RNA was extracted from sera following the manufacturer’s instructions (Sacace, REF K–2-C/100). RT-PCR was performed for each sample using a Cepheid Smart Cycler system and the detection was carried out using two reporter dyes monitored at two different wavelengths, one for HCV and the other for Internal Control (IC). Fluorescent intensities during RT-PCR were monitored to determine accumulated product and the cycle threshold (Ct) value, i.e. the number of PCR cycles required to exceed the IC fluorescence signal, was determined for each sample.
Samples yielding a Ct value lesser than 40 were considered positive for HCV-RNA, while those yielding a Ct value greater than 40 were considered PCR negative.
6
Quantitative RT-PCR Analysis of Mango Ripening
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA of postharvest mango stored for various lengths of time was obtained as described earlier in this article. These cDNA samples were used to conduct a quantitative RT‐PCR (RT‐qPCR) assay. The sequences designed for the MiETR1 gene‐specific primers were as follows: MiETR1F (5′‐CCTACAACTTCAACTCGGAACTT‐3′) and MiETR1R (5′‐TTCATCACCAACAGCATACTCAG‐3′). The sequences designed for the MiERS1 gene‐specific primers were as follows: MiERS1F (5′‐GTATTCTGCCACAAGACATTCCA‐3′) and MiERS1R (5′‐TCAAGACCTTCACTCTCAATCCA‐3′). The mango actin gene was used as an internal control with the following primers: MiactF (5′‐GTGGCTGTTAACGATCCCTT‐3′) and MiactR (5′‐GTGACTGGCTTCTCATCGAA‐3′). The synthesized cDNA was amplified as described earlier. RT‐qPCR was performed using the UltraSYBR Mixture (CWbio Co. Ltd., Beijing, China) in a SmartCycler® system (Cepheid). Relative gene expression was calculated using the comparative Ct method (ΔΔCt) (Livak & Schmittgen, 2001 ). A seriated template dilution experiment was conducted using the quantization method, and a calibration curve was created. Agarose gel electrophoresis was used to determine the PCR products. The size of the expected amplicon was 130 bp.
7
Quantification of vRNA and Cytokine mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For relative quantification of vRNA and cytokine mRNA in CEFs, total RNA was extracted from virus-infected CEFs samples by using RNeasy Mini Kit (Qiagen), according to the manufacturer’s instructions. The vRNA and IFN-stimulated genes (ISGs) were then quantified by real-time reverse transcriptase polymerase chain reaction (rRT-PCR) in a thermal cycler (Smart Cycler System, Cepheid, Sunnyvale, CA, USA) using One-Step SYBR Green Master Mix II (Takara, Dalian, Jiangsu, China) according to the manufacturer’s instructions. The primer sets for hemagglutinin (HA), polymerase basic 2 (PB2) genes, chicken IFN-α, chicken IFN-β, chicken myxovirus resistant 1 (chMx), chicken 2'-5' oligoadenylate synthetase (chOAS), chicken RNase L, and chicken protein kinase R (chPKR) mRNAs are listed in Additional file 1 : Table S1. The vRNA was quantified and compared to that in the mock-transfected control. The expression of cytokines and ISGs was normalized using the comparative 2-2∆∆Ct method, which was used to determine the mean fold increase in the expression level of the respective gene from the corresponding time point in the uninfected cell [21 (link)].
8
Quantitative RT-PCR Analysis of Chondrocyte Genes
9
Quantifying GAT-1 and GAT-3 Expression in Rat Brainstem
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rats (N = 6) were anesthetized with isoflurane, rapidly decapitated and the caudal portion of the medial and commissural nTS divisions bound by the area postrema and solitary tract (i.e., caudomedial nTS) was isolated. The nTS was then flash frozen and stored at −80°C until ready for use. RNA was isolated using the RNAqueous-Micro kit, following the manufacturer’s instructions (Ambion #AM1931, Life Technologies, Grand Island, NY, United States), and quantified (BioPhotometer Plus; Eppendorf, Hauppauge, NY, United States). cDNA was generated using 100 ng of mRNA (oligo-dT primer set, SuperScript III; Invitrogen #18080-051). Quantitative real-time PCR amplification of 2 μL of cDNA was performed using the SYBR Premix Ex Taq kit (Takara, Mountain View, CA, United States), the SmartCycler System (Cepheid, Sunnyvale, CA, United States), and the following primers: GAT-1 [NM_024371.1 (forward: AGA GGT CCA TAG CCG ATG TG, reverse CTC GGG GTA TGC CAA GAA T:)], GAT-3 [NM_024371.1 (forward: CTC CCG GCT CTC TGA TCC, reverse: GGC AGA TGG CAT AGG AGA AA)], and the housekeeping gene β2-microglobulin [(B2m, NM_0122512.2) (forward: AGC AGG TTC CTC AAA CAA GG, reverse: TTC TGC CTT GGA GTC CTT TC, 10 μM; Fisher Scientific)]. The relative quantity of GAT-1 and GAT-3 mRNA was normalized to B2m using the 2–ΔΔCT method (Livak and Schmittgen, 2001 (link)).
10
Fibroblast α7 nAChR Regulation by Nicotine
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary lung fibroblasts were plated onto 12-well plates (4 × 104 cells/well) and incubated in DMEM (10% FBS) for 24 h. Fibroblasts were transfected with α7 nAChR or control non-target siRNA (150 ng) according to the manufacturer’s protocol using HiPerFect Transfection Reagent (Qiagen). Transfected fibroblasts were treated with 50 μg/ml nicotine for up to 72 h. RNA was extracted from cells or lung tissue using the reagent RNAzol B™ (Tel-test Inc., Friendswood, TX). Real-time PCR was performed as previously described [17 (link)] utilizing the primers to mouse collagen type I, 18S, IL-1β, and α7 nAChR in a SmartCycler™ system (Cepheid Sunnyvale, CA). Primer sequences are as follows: Mouse collagen type I forward (5’-GTGCTGTTGGTGCTGCTG), reverse (5’-CAGGAGCACCAGCAATAC); 18S forward (5’-GTGACCAGAGCGAAAGCA), reverse (5’-ACCCACGGAATCGAGAAA); IL-1β forward (5’-GAGCACCTTCTTTTCC), reverse (5’-CTGGTGGAAGAAAAGG), probe; and α7 nAChR forward (5’-CTGCTGGGAAATCCTAGGCACACTTGAG or GACAAGACCGGCTTCCATCC), reverse (5’-CCTGGTCCTGCTGTGTTAAACTGCTTC). Negative controls consisted of dH2O and RNA without primers. Bioluminescent RT-PCR was accomplished according to a published method [18 (link)]. Values were normalized to 18S and expressed as relative change vs. untreated mouse lung tissue.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!