DNA oligonucleotides were obtained from Integrated DNA Technologies (except where otherwise specified). All mammalian editor plasmids used in this work were cloned by Gibson assembly according to manufacturer’s protocols. Except for the CRISPRi library, plasmids expressing sgRNAs were constructed by ligation of annealed oligonucleotides into BsmBI-digested acceptor vector as previously described24 (link),30 . Plasmids expressing pegRNAs were constructed by Golden Gate assembly using a custom acceptor plasmid as previously described38 (link). Protospacer sequences of sgRNAs used for non-library experiments in this work are listed in Supplementary Table 4 . pegRNA protospacer and extension sequences are listed in Supplementary Table 4 , tab #3 . Vectors for low-throughput mammalian cell experiments were purified using Plasmid Plus Midiprep kits (Qiagen) or PureYield plasmid miniprep kits (Promega), which include endotoxin removal steps. Cloning of the CBE SaCas9 sgRNA for screening was conducted by KLD assembly according to the manufacturer’s protocol using BPK2660 (Addgene #70709) as a template with the following primers (protospacer is bolded): GGTGTTTCGTCCTTTCCACAAGATA, gCTGATAGGCAGCCTGCACTGG GTTTTAGTACTCTGTAATGAAAATTACAGAATCTAC.
Pureyield plasmid miniprep kit
Manufactured by Promega
Sourced in United States, Japan
The PureYield Plasmid Miniprep kit is a laboratory tool designed for the rapid and efficient isolation of plasmid DNA from bacterial cultures. It provides a simple and reliable method for purifying plasmid DNA suitable for downstream applications such as sequencing, cloning, and transfection.
Automatically generated - may contain errors
Lab products found in correlation
Plasmid plus midiprep kit, by Qiagen (5 mentions)
Phusion u green multiplex pcr master mix, by Thermo Fisher Scientific (5 mentions)
Q5 hot start high fidelity 2x master mix, by New England Biolabs (4 mentions)
High fidelity phusion green hot start 2, by New England Biolabs (2 mentions)
Wild type c57bl 6 mice, by Charles River Laboratories (2 mentions)
Cy5 labeled dna oligonucleotides, by Integrated DNA Technologies (2 mentions)
Dcas9 protein, by Integrated DNA Technologies (2 mentions)
Cas9 h840aprotein, by Integrated DNA Technologies (2 mentions)
Bsmbi digestedacceptor vector, by Addgene (2 mentions)
Usingplasmid plus midiprep kits, by Qiagen (2 mentions)
Qiaprep spin miniprep kit, by Promega (2 mentions)
Plasmid plus maxiprep or midiprep kits, by Qiagen (2 mentions)
Zymopure 2 midi prep kit, by Zymo Research (2 mentions)
Geneclean 2 kit, by MP Biomedicals (2 mentions)
Pgem t easy cloning kit, by Promega (2 mentions)
Kod plus neo dna polymerase, by Toyobo (2 mentions)
Plasmid plus midi kit, by Qiagen (1 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (1 mentions)
Milli q, by Merck Group (1 mentions)
23 protocols using pureyield plasmid miniprep kit
1
Plasmid Construction for Genome Editing
2
Plasmid Cloning for Prime Editing
3
Plasmid Construction for CRISPR Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA amplification was conducted by PCR using Phusion U Green Multiplex
PCR Master Mix (ThermoFisher Scientific) or Q5 Hot Start High-Fidelity 2x Master
Mix (New England BioLabs) unless otherwise noted. DNA oligonucleotides,
including Cy5-labeled DNA oligonucleotides, dCas9 protein, and Cas9 H840A
protein were obtained from Integrated DNA Technologies. Yeast reporter plasmids
were derived from previously described plasmids39 and cloned by the Gibson assembly
method. All mammalian editor plasmids used in this work were assembled using the
USER cloning method as previously described40 . Plasmids expressing sgRNAs were constructed by
ligation of annealed oligonucleotides into BsmBI-digested
acceptor vector (Addgene plasmid #65777). Plasmids expressing pegRNAs were
constructed by Gibson assembly or Golden Gate assembly using a custom acceptor
plasmid (seeSupplementary
Note 3 ). Sequences of sgRNA and pegRNA constructs used in this work
are listed inSupplementary
Tables 2 and 3 . All vectors for mammalian cell experiments were purified using
Plasmid Plus Midiprep kits (Qiagen) or PureYield plasmid miniprep kits
(Promega), which include endotoxin removal steps. All experiments using live
animals were approved by the Broad Institute Institutional and Animal Care and
Use Committees. Wild-type C57BL/6 mice were obtained from Charles River
(#027).
PCR Master Mix (ThermoFisher Scientific) or Q5 Hot Start High-Fidelity 2x Master
Mix (New England BioLabs) unless otherwise noted. DNA oligonucleotides,
including Cy5-labeled DNA oligonucleotides, dCas9 protein, and Cas9 H840A
protein were obtained from Integrated DNA Technologies. Yeast reporter plasmids
were derived from previously described plasmids39 and cloned by the Gibson assembly
method. All mammalian editor plasmids used in this work were assembled using the
USER cloning method as previously described40 . Plasmids expressing sgRNAs were constructed by
ligation of annealed oligonucleotides into BsmBI-digested
acceptor vector (Addgene plasmid #65777). Plasmids expressing pegRNAs were
constructed by Gibson assembly or Golden Gate assembly using a custom acceptor
plasmid (see
Note 3
are listed in
Tables 2
Plasmid Plus Midiprep kits (Qiagen) or PureYield plasmid miniprep kits
(Promega), which include endotoxin removal steps. All experiments using live
animals were approved by the Broad Institute Institutional and Animal Care and
Use Committees. Wild-type C57BL/6 mice were obtained from Charles River
(#027).
4
Plasmid Cloning for Prime Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids expressing pegRNAs and epegRNAs were cloned either by Gibson assembly, Golden Gate assembly using either a previously described custom acceptor plasmid14 (link) or newly designed custom acceptor plasmids that contain trimmed evopreQ1 or mpknot (the use of which is described in Supplemental Note 1 ), or synthesized and cloned by Twist Biosciences. Plasmids expressing sgRNAs were cloned via Gibson or USER assembly. DNA amplification was accomplished by PCR with Phusion U or High Fidelity Phusion Green Hot Start II (New England Biolabs). Plasmids expressing pegRNAs were purified using PureYield plasmid miniprep kits (Promega) when transfecting HEK293T cells or Plasmid Plus Midiprep kits (Qiagen) when transfecting other cell types, while plasmids expressing prime editors were purified exclusively using Plasmid Plus Midiprep kits. Plasmids ordered from Twist Biosciences were resuspended in nuclease-free water and used directly. Primers and dsDNA fragments were ordered from Integrated DNA Technologies (IDT). Uncropped agarose and northern blot gels are provided in Supplementary Figs. 16 and 17 .
5
Plasmid Construction for CRISPR Editing
6
Plasmid Construction for CRISPR-Cas9 Experiments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA amplification was conducted by PCR using Phusion U Green Multiplex PCR Master Mix (ThermoFisher Scientific) or Q5 Hot Start High-Fidelity 2x Master Mix (New England BioLabs) unless otherwise noted. DNA oligonucleotides were obtained from Integrated DNA Technologies. Plasmids expressing sgRNAs were constructed by ligation of annealed oligonucleotides into BsmBI-digested acceptor vector as previously described1 .Plasmids expressing pegRNAs were constructed by Gibson assembly or Golden Gate assembly as previously described1 . Sequences of sgRNA and pegRNA constructs used in this work are listed in Supplementary Table 1 . All vectors for mammalian cell experiments were purified using Plasmid Plus Midiprep kits (Qiagen), PureYield plasmid miniprep kits (Promega), or QIAprep Spin Miniprep kits. Synthetic pegRNAs were ordered from IDT without HPLC purification.
7
Cloning Expression Vectors and Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression vectors for tissue culture were cloned using KLD, Gibson or USER assembly. sgRNA expression plasmids were cloned via KLD or Goldengate assembly to install protospacers as indicated in Supplementary Table 1 . Plasmids were constructed via USER assembly or Gibson assembly of PCR-amplified fragments. Plasmids encoding recombinant AAV (rAAV) genomes were cloned by Gibson assembly of plasmid restriction fragments and PCR amplicons with Gibson-compatible overhangs. All plasmids for mammalian tissue culture experiments were purified using Plasmid Plus Maxiprep or Midiprep kits (Qiagen), ZymoPURE II Midiprep kit (Zymo Research) or PureYield Plasmid Miniprep kits (Promega). Key plasmids developed in this study will be available through Addgene.
8
Cloning Diverse Guide RNA Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Guide RNA expression plasmids (pegRNAs, epegRNAs, ngRNAs, dsgR-NAs and sgRNAs) were cloned as previously described using isothermal assembly and synthetic gene fragments 61 (link) . Guide RNA sequences are provided in Supplementary Table 2. Guide RNA expression plasmids were purified using PureYield Plasmid Miniprep kits (Promega). Prime editor and MLH1dn plasmids were purified using Qiagen Plasmid Plus Midi kit (Qiagen). DNA PCR amplification was completed using Phusion U Green Multiplex PCR master mix (Thermo Fisher Scientific). Primers and gene fragments were ordered from Integrated DNA Technologies. New prime editor plasmids were cloned using isothermal assembly, and sequences are provided in Supplementary Information.
9
Plasmid Construction for CRISPR-Cas9 Experiments
10
Molecular Cloning of Chimeric Dynein-SRS Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard molecular cloning methods were used to create chimeric constructs of monomeric Thermus thermophilus seryl-tRNA synthetase (SRS) fused to the stalk and MTBD of yeast dynein using SRS85:82, a construct with the near full-length mouse stalk and MTBD fused to the coiled-coil base of SRS in the α-registry27 (link),33 (link) as a template. Genomic yeast DNA was amplified to generate DNA fragments of the dynein stalk and MTBD. PCR products were then stitched with partial SRS sequences to enable insertion between the restriction enzyme sites, SalI and PstI, of the original vector (see Supplementary Table 2 for the list of primers used). Single point mutations in the SRS chimeras were generated using the Q5 site-directed mutagenesis kit from NEB. High efficiency 5-α competent E. coli cells (NEB) were used for transformation and plasmid amplification. Single colonies were inoculated in 3 mL of terrific broth (TB) with 30 μg/mL of kanamycin and grown overnight shaking at 37 °C. Plasmids (listed in Supplementary Table 1 ) were purified using the PureYield plasmid miniprep kit from Promega and verified by standard sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!