T2, a human TAP-deficient HLA-A2+ cell line, and HEK 293 T were obtained from ATCC (Rockford, MD). 624 MEL, a melanoma cell line was previously described (Bethesda, MD)41 (link). GPRTG, a 293 T-based packaging cell line for production of lentiviral vector particles, was obtained from the National Gene Vector Biorepository (Indiana University, Indianapolis, IN)42 (link). T2 cells were maintained in RPMI (Thermo Fisher, Walther, MA) with 10% heat-inactivated fetal bovine serum (HI-FBS; Tissue Culture Biologics, Long Beach, CA). All other cell lines were maintained in DMEM (Thermo Fisher) with 10% HI-FBS. 1 ng/mL doxycycline (Clontech Laboratories, Palo Alto, CA) was added to DMEM for GPRTG cells. Cells were maintained at 37 °C in a humidified 5% CO2 incubator.
Dulbecco modified eagle medium (dmem)
Manufactured by Takara Bio
Sourced in Japan, United States
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium commonly used to support the growth and maintenance of various cell lines. It is a chemically-defined, nutrient-rich medium that provides cells with essential amino acids, vitamins, salts, and other components necessary for cellular metabolism and proliferation. DMEM supports the growth of a wide range of cell types, including adherent and suspension cultures.
Automatically generated - may contain errors
Lab products found in correlation
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (7 mentions)
Pen strep, by Thermo Fisher Scientific (4 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Penicillin, by Thermo Fisher Scientific (2 mentions)
Streptomycin, by Thermo Fisher Scientific (2 mentions)
L glutamine, by Thermo Fisher Scientific (2 mentions)
Dulbecco modified eagle medium (dmem), by Merck Group (2 mentions)
β glycerophosphate, by Takara Bio (2 mentions)
Doxycycline, by Takara Bio (1 mentions)
Roswell park memorial institute (rpmi), by Thermo Fisher Scientific (1 mentions)
Hek293t, by American Type Culture Collection (1 mentions)
Hi fbs, by Thermo Fisher Scientific (1 mentions)
Fetal calf serum (fcs), by Takara Bio (1 mentions)
Penicillin, by Takara Bio (1 mentions)
Streptomycin, by Takara Bio (1 mentions)
Doxycyclin, by Takara Bio (1 mentions)
Fetal calf serum (fcs), by Thermo Fisher Scientific (1 mentions)
Tet system approved fetal calf serum, by Takara Bio (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Zeocin, by InvivoGen (1 mentions)
13 protocols using dulbecco modified eagle medium (dmem)
1
Lentiviral Vector Production for TAP-Deficient Cells
2
Cell Culture and siRNA Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Burkitt lymphoma cells (BL2) were cultured in RPMI medium 1640 (GIBCO) with 10% fetal calf serum (GIBCO), 10 000 U/ml penicillin and 10 mg/ml streptomycin (Gibco-BRL). LoVo cells were grown in 50% DMEM (GIBCO), 50% F12 (GIBCO) supplemented with 10% fetal calf serum and penicillin-streptomycin, 293T Lα were cultured in DMEM supplemented with 10% Tet System-approved fetal calf serum (Clontech), 300 μg/ml hygromycin B (Roche) and 100 μg/ml zeocin (InvivoGen). To abrogate MutLα expression, 50 ng/ml doxycyclin (Clontech) was added to the media. siRNA transfections were carried out using the calcium phosphate transfection. Synthetic siRNA oligonucleotides sequences (all 5′ to 3′) were as follows: siLuc sequence CGTACGCGGAATACTTCGATT, siMSH2 UCCAGGCAUGCUUGUGUUGAATT and MSH6 CGCCATTGTTCGAGATTTA (Microsynth).
3
Maintenance of Mouse Embryonic Fibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Unless otherwise specified, all cell lines were obtained from the American Type Culture Collection (ATCC) (Rockville, MD, USA). Both Atg7 -wild type and -knockout mouse embryonic fibroblasts (MEFs) were kindly provided by Masaaki Komatsu (Juntendo University, Tokyo, Japan). All cells were maintained in DMEM supplemented with fetal bovine serum (10%), penicillin (50 U/mL) and streptomycin (50 μg/mL) (Invitrogen, Scotland, UK) at 37 °C with CO2 (5%), except PC-12 cells which were maintained in horse serum (10%). Dox- inducible PC-12 cell line was cultured with DMEM supplemented with horse serum (10%), Tet system approved fetal bovine serum (5%) (Clontech, CA, USA) in the presence of G418 (200 μg/mL).
4
Comparative Analysis of HTC75 and IMR90 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HTC75 and IMR90 (human diploid lung fibroblasts) (ATCC® CCL-186™) cell lines were employed. HTC75 is a derivative of HT1080 (human fibrosarcoma). IMR90 was used at population doubling 30. HTC75 cells were cultured in DMEM (Cellgro) with 10% BCS (HyClone), 1% penicillin and streptomycin (Cellgro) and 1% L-glutamine (Gibco). IMR90 cells were cultured in DMEM with 20% FBS (ClonTech), and 1% penicillin and streptomycin. Both cell lines were grown in cell culture incubator at 37 °C with 5% CO2.
5
Lentiviral Knockdown of CDCA4 in TNBC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shCDCA4 constructs targeting the CDCA4 cDNA sequence (5′-CCTAGACCTAAGAGTAAATTA-3′) were synthesized and cloned into the GV115 lentiviral vector (Shanghai GeneChem Co., Ltd., Shanghai, China). Subsequently, 293T cells were co-infected with lentiviral vector carrying the shCDCA4 or negative control shRNA (shCtrl; 5′-TTCTCCGAACGTGTCACGT-3′; Shanghai GeneChem Co., Ltd.) and packaging plasmids. The lentiviruses were then harvested and the virus titer was determined. Additionally, the lentiviral vectors carried firefly luciferase and green fluorescent protein (GFP) genes to label tumor cells. The TNBC cell lines were transfected with lentivius (MOI=10) in a 24-well plate (5×104 cells/well). Following transfection for 24 h, the fresh complete medium was replaced and the cells were cultured for an additional 72 h at 37°C. These lentiviruses were used to stably knockdown CDCA4 expression in MDA-MB-231 and MDA-MB-468 breast cancer cell lines, and shRNA-infected cells were selected in puromycin (5 ug/ml)-containing DMEM (Clontech Laboratories, Inc., Mountainview, CA, USA). The images of infected cells were observed under a phase-contrast and fluorescence microscope (Olympus Corporation, Tokyo, Japan).
6
Renal and Lung Cancer Cell Lines
7
Cell Culture Conditions and Maintenance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293 (ATCC), HeLa (ATCC), and SLK cells were maintained in DMEM (Thermo Fisher) containing 10% FBS (VWR), 1% Pen-Strep (Thermo Fisher), and 1% l -glutamine (Thermo Fisher). 293TT cells (a kind gift from Dr. Cary Moody) were maintained in in DMEM containing 10% FBS (Sigma-Aldrich) and 1% Pen-Strep. iSLK.219 cells were maintained in DMEM containing 10% Tet-free FBS (Clontech), 1% Pen-Strep, 1% l -glutamine, 10 μg/mL puromycin (Corning), 250 μg/mL Geneticin (Thermo Fisher), and 400 μg/mL hygromycin B (Corning). BCBL1-TREx-RTA cells (a kind gift from Dr. Jae Jung) were maintained in RPMI 1640 (Corning) containing 10% Tet-free FBS (Clontech), 1% Pen-Strep, 1% l -glutamine, 1% sodium bicarbonate (Thermo Fisher), 0.05 mM β-mercaptoethanol (Thermo Fisher), and 200 μg/mL hygromycin. AGS-EBV cells (a kind gift from Dr. Lindsey Hutt-Fletcher) were maintained in F-12 media (Thermo Fisher) containing 10% FBS (VWR), 1% Pen-Strep, 1% l -glutamine, and 500 μg/mL Geneticin. Akata-BX1 cells (a kind gift from Dr. Lindsey Hutt-Fletcher) were maintained in RPMI 1640 containing 10% FBS (VWR), 1% Pen-Strep, 1% l -glutamine, 0.05 mM mercaptoethanol, and 500 μg/mL Geneticin. AGS cells (ATCC) were maintained in F-12 media containing 10% FBS (VWR), 1% Pen-Strep, and 1% l -glutamine. All cells were maintained at 37 °C and 5% CO2 in a regularly cleaned and decontaminated laboratory incubator.
8
GBM Cell Lines and Culture Conditions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The adherent GBM cell lines LN-229, LN-319, LN-18 and LN-428, have been established in our lab as well as the sphere line LN-2669GS. 44, 45 The lines were authenticated by DNA fingerprinting. 46 The adherent cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM, Invitrogen), supplemented with 5% fetal calf serum (Hyclone) and 100 units/ml penicillin & streptomycin (Invitrogen). The sphere line LN-2669GS was cultured under stem-cell conditions using DMEM/F12 medium containing B27 supplement and 20 ng/ml of both epidermal growth factor (EGF) and fibroblast growth factor 2 (FGF2).
LN-229_indWIF1 and LN-229_ind_dsRED were treated with doxocyclin (DOX, Clontech) at 1µg/ml. The following small molecule inhibitors were used: SB203580 (Calbiochem, La Jolla, CA) and SB239063 (SIGMA, cat# S0569) specific for p38-MAPK, and the MEK 1/2 inhibitor U0126 (Cell Signalling # 9903) for the inhibition of ERK 1/2.
LN-229_indWIF1 and LN-229_ind_dsRED were treated with doxocyclin (DOX, Clontech) at 1µg/ml. The following small molecule inhibitors were used: SB203580 (Calbiochem, La Jolla, CA) and SB239063 (SIGMA, cat# S0569) specific for p38-MAPK, and the MEK 1/2 inhibitor U0126 (Cell Signalling # 9903) for the inhibition of ERK 1/2.
9
Cell Culture Protocols for HeLa, THP-1, and LentiX293T
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa cells (gifted from Dr. Kenji Tago) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Wako, Osaka, Japan) supplemented with 10% fetal calf serum (FCS) and antibiotics. THP-1 cells (ATCC) were cultured in RPMI1640 (Sigma, St Louis, MO, USA) supplemented with 10% FCS and antibiotics. THP-1 macrophages were differentiated with 200 nM phorbol-12-myristate-13-acetate (PMA) for 24 hr. LentiX293T cells were obtained from TAKARA (Takara Bio, Shiga, Japan) and cultured in DMEM supplemented with 10% FCS, 1 mM sodium pyruvate, and antibiotics. Unless otherwise indicated, cells were cultured at 37°C in 5% CO2. Cell lines were authenticated by analysis of short tandem repeat profiling (BEX, Tokyo, Japan) and confirmed as negative for mycoplasma contamination using TaKaRa PCR Mycoplasma Detection Set (Takara Bio) and Hoechst staining.
10
Metastatic Tongue Squamous Cell Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HSC3 cell line, which originated from a metastatic focus of a human tongue squamous cell carcinoma, was purchased from the Health Science Research Resources Bank (Osaka, Japan). HSC3 cells were maintained in DMEM containing 450 mg/dL glucose and 10% FBS in a 5% CO2 atmosphere at 37°C. These reagents were purchased from Dako (Osaka, Japan) as were glucose‐free DMEM and the ME inhibitor lanthanide (used at 1 μmol/L).25 , 26 Mitochondria were stained with MitoGreen solution (Takara Bio, Kusatsu, Japan) and observed by fluorescence microscopy (Zeiss, Tokyo, Japan).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!