Sybr green master kit

Total RNA was isolated from lung tissues using Trizol reagent (Invitrogen), digested with RNase-free DNase and purified using an RNeasy MinElute kit (QIAGEN). Reverse transcription was done using Oligo-dT First-Strand cDNA Synthesis Kit (GE Healthcare, Piscataway, NJ). Quantitative PCR (qPCR) was done using the SYBR Green Master Kit and LightCycler® 480 instrument (Roche Diagnostics, Indianapolis, IN). All primers used are listed in Table S1.

DNase I-treated total cellular RNA was reverse-transcribed into cDNA using a QuantiTect Reverse Transcription Kit (Qiagen). The expression of different cellular genes was determined by quantification of specific mRNAs using commercial QuantiTect Primer Assays (Qiagen; primer sequences are not available). Real-time PCR was performed using a SYBR Green Master kit (Roche) in the Roche LightCycler 480 system. For each sample, RT-PCR was performed in triplicate. The expression levels of each gene are presented as values normalized against 10⁶ β-actin transcripts.

Total RNA from cultured cells and tissue specimens was extracted using TRIZOL reagent (Invitrogen, USA). A total of 2 μg per sample RNA was used for complementary DNA synthesis using Oligo (dT)15 primers reagents kit (Promega, USA). Real-time PCR (RT-PCR) was carried out in LightCycler^@ using an SYBR^@ Green Master kit (Roche, Switzerland). The primer sequences are as follows: 18S, 5′-CGGCTACGACATCCAAGGAA-3′ and 5′-GCTGGAATTAGCGCGGCT-3′; hRPRD1A, 5′-ATGGTAGAGGATGCGTGTATGT-3′ and 5′-AAGGGCTTCCTTTTGACAACG-3′; hNRF2, 5′-CACATCCAGTCAGAAACCAGTGG-3′ and 5′-GGAATGTCTGCGCCAAAAGCTG-3′; hSOD1, 5′-AGGGCATCATCAATTTCGAGC-3′ and 5′-GCCCACCGTGTTTTCTGGA-3′; hSOD2, 5′-AACCTCAGCCCTAACGGTG-3′ and 5′-AGCAGCAATTTGTAAGTGTCCC-3′; hANT, 5′-TCCCCACCCAAGCTCTCAA-3′ and 5′-GTCCAGCGGGTAGACAAAGC-3′; hGCLC, 5′-AGAGAAGGGGGAAAGGACAAAC-3′ and 5′-AAGTTATTGTGCAAAGAGCCTGAT-3′; hGCLM, 5′-TCAGGGAGTTTCCAGATGTCTTG-3′ and 5′-TGAAGCAATGATCACAGAATCCA-3′; hNQO1, 5′-GCAGTTTCTAAGAGCAGAAC-3′ and 5′-GTAGATTAGTCCTCACTCAGCCG-3′; hPRDX4, 5′-GCAAAGCGAAGATTTCCAAG-3′ and 5′-GGCCAAATGGGTAAACTGTG-3′; hPRDX6, 5′-GCATCCGTTTCCACGACT-3’ and 5′-TGCACACTGGGGTAAAGTCC-3′; HO1, 5′-GGGCTAGCATGCGAAGTGAG-3′ and 5′- AGACTCCGCCCTAAGGGTTC -3′.

A total of 11 differentially regulated mRNAs obtained from integrative analysis of multi-omics were verified with quantitative real-time PCR (qRT-PCR). Primers for qRT-PCR were listed in Additional file 14: Table S12. qRT-PCR with β-actin as an internal control was used to explore mRNA expression. qRT-PCR was performed with an SYBR Green Master kit according to the manufacturer’s protocol (Roche, Basel, Switzerland). The experiments were carried out in triplicate with a total volume of 20 μL in an ABI StepOnePlus, containing 10 μL SYBR Green Master, 4 μL cDNA (500 ng), and 3 μL forward and reverse primers (2 μmol/L). The qRT-PCR was programmed at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, and 55 °C for 1 min. The expression level was calculated by the 2^-△△CT method and subjected to statistical analysis.

Total RNA was extracted from HNSCC cells using TRIzol Reagent (Sigma) following the manufacturer's instructions. For evaluation of miR‐335‐5p, reverse transcription and quantification were conducted using the Bulge‐Loop miRNA qRT–PCR Starter Kit (RiboBio). For evaluation of MAP3K2 mRNA, reverse transcription was performed by the Reverse Transcription Kit (Roche, Switzerland). PCR was performed using the SYBR Green Master Kit (Roche, Rotkreuz, Switzerland). U6 or GAPDH mRNA served as internal controls. Gene expression was calculated using the 2‐ΔΔCt method. The primer sequences are listed in Table 1.

Total RNA from 186 fresh-frozen KIRC tissue samples was extracted using the RNAiso plus kit (TAKARA) according to the manufacturer’s instructions, and the expression of the model-related genes was further examined by qRT-PCR. The complementary DNA (cDNA) was synthesized with PrimeScript RT Reagent kit (TAKARA) according to the manufacturer’s instructions. The qRT-PCR was performed on LightCycler 480 II System (Roche) using an SYBR Green Master Kit (Roche). Human β-actin was introduced as an internal reference gene to normalize mRNA levels. Expression levels of each mRNA were calculated using the −△Ct method. All trials were conducted in triplicate. The primers are presented in Supplementary Table 1.

Total RNA was extracted from tissues and cells using Trizol (Invitrogen) according to the manufacturer’s instruction and as described previously^{30 (link)}. PCR primer sequences (Supplementary Table S2) were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). Reaction conditions of cDNA synthesis were as 30 °C for 10 min, 42 °C for 50 min, 85 °C for 5 min, 4 °C for 60 min. PCR amplification was performed at 95 °C for 10 min, followed by 40 cycles of 95 °C for 10 s and 60°C for 31 s using an SYBR Green Master kit (Roche Applied Science). Samples were run in triplicate and experiments were repeated at least three times. The expression level of PNPO mRNA normalized to an endogenous control β-actin or target miRNA normalized to its control U6 was calculated using 2^ΔΔCt, in which threshold cycle (Ct) was obtained using Sequence Detection Software V1.4 (7300 Real Time PCR System, Applied Biosystems, Foster City, CA, USA).