Quantifast multiplex rt pcr kit

RNA was extracted from 140 µL of the collected samples using the QIAamp 96 Virus QIAcube HT kit (Qiagen, Manchester, UK), according to the manufacturer’s instructions. Samples were screened for 15 virus targets [26 ]—HRV, respiratory syncytial virus (A and B), human coronaviruses (OC43, NL63, and E229), influenza (A, B, and C), parainfluenza (1–4), adenovirus and human metapneumovirus—using in-house multiplexed real-time reverse transcription polymerase chain reaction (rRT-PCR) with a QuantiFast Multiplex RT-PCR kit (Qiagen, Manchester, UK) [28–30 (link)]. A sample was considered HRV positive if the rRT-PCR cycle threshold (Ct) value was <35.

To quantify the genome copy (GC) number in each sample, a qmosRT-PCR was used. Briefly, the qmosRT-PCR reactions were prepared with a QuantiFast Multiplex RT-PCR Kit (QIAGEN, Valencia, CA, USA) in 96-well optical plates in a final volume of 25 μL using 2 μL of RNA of test and control samples and 2 μL of DNA-plasmid for standard references. The RNAs of nOPV2-c1 virus were used as positive controls, and water was used as negative control. Plasmid containing the genome of nOPV2-c1 mutant virus with a known GC number was used as a standard reference for extrapolation of the GC for nOPV2 mutants as test samples, and plasmid containing the genome of nOPV2-c1 non-mutant virus with a known GC number was used as standard reference for extrapolation of the GC number for nOPV2-c1 non-mutants as test samples.
All control and standard reference samples were run in duplicate, and the test samples were run in three repeats. The specific primer pairs and probes used for each virus are presented Table 1. The qmosRT-PCR procedure was performed as described above.

Cells were lysed at assigned time points, and total RNA was isolated using the RNeasy plus kit (Qiagen, Sweden). RNA was analyzed using quantitative reverse transcriptase multiplex polymerase chain reaction (RT-qPCR) (Quantifast^® Multiplex RT-PCR kit; Qiagen) to amplify both HTT and HPRT1 (serving as an endogenous control). Sequences of primers and probes for HTT and HPRT1 (Sigma) were as follows: HTT-fwd: 5′-gactcgaacaagcaagag, HTT-rev: 5′-gcctttaacaaaaccttaatttc; HPRT1-fwd: 5′-gagctattgtaatgaccagtc, HPRT1-rev: 5′-tgaccaaggaaagcaaag; HTT TaqMan probe: 5′-[JOE]gaagaatcagtccaggagacc[BHQ1] and HPRT1 TaqMan probe: 5′-[6FAM]tgccagtgtcaattatatcttccacaa[BHQ1]. JOE and 6-FAM represent two fluorophores with different emission spectra and (BHQ1) is a Black Hole Quencher. The multiplex RT-qPCR setup was performed according to the Quantifast kit protocol using 35 ng of RNA for all reactions and a final volume of 25 μL per reaction.
Cycling conditions of PCR were as follows: 20 min at 50°C for reverse transcription, 5 min, 95°C for PCR initial activation step and 45 cycles, each of 2 steps: 15 s, 95°C denaturation and 30 s, 60°C for annealing/extension. Quantitative RT-PCR was performed using the StepOnePlus^® Real-time PCR system (Applied Biosystems, Sweden) and the data were analyzed by the ΔΔC_t method using the StepOne^® software version 2.2.

Vero cells (ATCC #CCL81) and A549 cells (ATCC #CCL185) were cultured in Dulbecco’s Modified Eagle Medium (Thermo Fisher Scientific, Waltham, MA, USA), supplemented with 5% (Vero) or 10% (A549) fetal bovine serum (FBS, Atlanta Biologicals, Flowery Branch, GA, USA) and 50 μg/mL gentamycin (Thermo Fisher Scientific, Waltham, MA, USA).
Infectious iVDRV isolates were recovered from snap-frozen skin biopsy tissues. Skin tissues were homogenized in DMEM media supplemented with 2% FBS and 1% antibiotic/antimycotic solution (Thermo Fisher Scientific, Waltham, MA, USA) using 3-mm zirconium beads (Sigma-Aldrich, Burlington, MA, USA) and then inoculated into subconfluent monolayers of Vero cells as previously described [12 (link)]. Passage 2 iVDRV viral stocks were used as “golden stocks” for subsequent propagation. Preparation of concentrated iVDRV viral stocks (passage 4) with a Jumbosep 300K centrifugal device (PALL Life Sciences, New York, NY, USA), and determination of viral titers by immunocolorimetric foci assay have been published previously [12 (link)]. RuV presence in the culture medium was confirmed by real-time RT-PCR using a QuantiFast Multiplex RT-PCR Kit (Qiagen, Hilden, Germany) and rubella virus-specific primers and probes [12 (link)].

Minimal essential medium (MEM), fetal bovine serum (FBS), penicillin and streptomycin solution, and 0.25% (v/v) trypsin-EDTA were purchased from Gibco (Carlsbad, CA). Sodium pyruvate, sodium bicarbonate, and nonessential amino acids were purchased from Sigma-Aldrich (St. Louis, MO). Furafylline, β-naphthoflavone, omeprazole, dexamethasone, ketoconazole, dimethylsulfoxide (DMSO), methanol, and natural compounds such as andrographolide, bergamottin, curcumin, lycopene, and resveratrol were purchased from Sigma-Aldrich. The iScript™ One-Step RT-PCR Kit With SYBR® Green was purchased from Bio-Rad Laboratories (Hercules, CA), QIAshredder™, RNeasy® Mini Kit, QuantiFast® Multiplex RT-PCR kit, HotStarTaq® Plus DNA polymerase, and dNTPs mix was obtained from Qiagen (Venlo, Limburg, Netherlands). Primary antibodies against CYP1A2, CYP2D6, and CYP3A4 were bought from Millipore (Billerica, MA) while the primary antibody for β-actin and secondary antibody (anti-rabbit IgG, HRP-linked) was obtained from Cell Signaling Technology (Beverly, MA). Primers were synthesized by Bioneer (Daejeon, Korea) and probes were synthesized by Sigma-Aldrich.

QuantiFast Multiplex RT-PCR Kit (Qiagen) was used for RT-qPCR analysis. According to the kit instructions, an aliquot of 25 μL reaction system was mixed and amplified using the Applied Biosystem 7500 fluorescence quantitative PCR instrument (Darmstadt, Germany). Primers used for this study were listed in Table 3. The 2^-ΔCt method was used to calculate the relative expression of the target genes where ΔCt_miRNA = Ct_miRNA − C_{thousekeeping.}Table 3

Primer sequences used in this study

miRNAs	Primer Sequences 5′-3′
hsa-miR-3113-5p	GTCCTGGCCCTGGTCCGGGTCC
hsa-miR-499a-5p	TTAAGACTTGCAGTGATGTTT
hsa-miR-223-3p	TGTCAGTTTGTCAAATACCCCA
hsa-miR-133a-3p	TTTGGTCCCCTTCAACCAGCTG

The quantitative one-step RT-PCR (qosRT-PCR) reactions were prepared in 96-well optical plates in a final volume of 25 μL using 2 μL of viral RNA and QuantiFast Multiplex RT-PCR Kit (QIAGEN, Valencia, CA, USA). The RNA from Sabin 2 virus with known titer (expressed as CCID₅₀/mL) was subject to serial 10-fold dilution and used as reference standard to generate the standard curve (at least the concentrations of 10⁶ to 10 CCID₅₀/mL of the diluted samples were run in triplicates). The Sabin 2 RNA and plasmid-containing Sabin 2 genome were used as positive control, and water, nOPV2 RNA and plasmid-containing nOPV2 genome were used as negative controls. All control samples were run in quadruplicates. The specific primers and probe used for detection and quantitation of Sabin 2 strain are presented in Table 1. Oligonucleotide probe Sab2PrbFAM2 was used at a final concentration of 25 nM, and primers Sab2-605R (reverse) and Sab2-538F (forward) were used at a final concentration of 0.8 μM. The qosRT-PCR procedure was performed using real-time PCR System ViiA7 (Thermo Fisher Scientific, South San Francisco, CA, USA) at the following thermal cycling conditions: one cycle incubation for 20 min at 50 °C and 5 min at 95 °C, followed by 40–45 cycles, each consisting of 15 s at 94 °C, 15 s at 55 °C, and 30 s at 60 °C.