A 1438 bp genomic sequence corresponding to the entire zebrafish gpr101 gene (ENSDARG00000039218) was cloned into the pCS2 vector and a DIG-labeled RNA antisense probe was synthesized by in vitro transcription (DIG RNA Labeling Kit (SP6/T7), Sigma-Aldrich, St. Louis, MO, USA) following manufacturer’s protocol. The gh1 antisense probe was a generous gift of Dr. Alberto Rissone (NIH, Bethesda, USA). WISH was then performed in WT EK embryos collected at different stages of development as previously described (Thisse and Thisse 2008 (link)). Staining with sense probes for both gpr101 and gh1 showed no staining, as expected (data not shown). Double WISH/immunofluorescence was performed as previously described (Barresi, et al. 2005 (link)). The following antibodies were used: rabbit polyclonal anti-PRL (1:500, generous gift of Dr. Akiyoshi Takahashi, Kitasato University, Japan), mouse monoclonal anti-tyrosine hydroxylase (1:400, MAB318, clone LNC1, EMD Millipore, Billerica, MA), and appropriate rabbit/mouse secondary Alexa Fluor 488 (1:400, ThermoFisher Scientific, Waltham, MA USA). Stained embryos were cleared in glycerol and photographed.
Dig rna labeling kit sp6 t7
Manufactured by Merck Group
Sourced in United States
The DIG RNA Labeling Kit (SP6/T7) is a laboratory product that enables the in vitro transcription of labeled RNA probes using SP6 or T7 RNA polymerase. The kit provides the necessary reagents to generate digoxigenin-labeled RNA probes for applications such as Northern blotting, in situ hybridization, and RNase protection assays.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using dig rna labeling kit sp6 t7
1
Zebrafish gpr101 Gene Expression
2
SARS-CoV-2 mRNA Detection by Northern Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from cells infected with B.1.1or B.1.1-Akaluc and were subjected to Northern blot analysis as previously described.20 (link) In brief, a digoxigenin (DIG)-labeled random-primed probe, corresponding to 28,999 to 29,573 of the SARS-CoV-2 genomes, was generated by using a DIG RNA Labeling kit (SP6/T7) (Sigma-Aldrich), and utilized to detect viral mRNAs. The RNAs were washed with the DIG luminescent detection kit (Sigma-Aldrich) and were visualized with CDP-Star Chemiluminescent Substrate (Sigma-Aldrich), according to the manufacturer’s protocols. Bands were detected by WSE-6100LuminoGraphI (Atto).
3
Slc4a8 cDNA In Situ Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR product of mouse Slc4a8 cDNA fragment, encoded by the primers ATCGGCACCACCGCACTCAT (sense) and AGCAGGGCTTCCCGCACTTT (antisense), was purified and ligated into a pGEM-T Easy Vector (Promega, Madison, WI). The plasmid was linearized using SacII and BstXI restriction enzymes for antisense and sense cRNA synthesizing, respectively. The antisense and sense cRNA probes were synthesized using DIG RNA Labeling Kit (SP6/T7) (Sigma Aldrich, St. Louis, MO). In situ hybridization experiments were performed on normal mouse brain and kidney sections using a in situ hybridization kit (Biochain, Newark, CA). Briefly, the paraffin slides were deparaffinized and rehydrated, fixed with 4% paraformaldehyde, treated with 10ug/ml proteinase K 15 minutes, subjected to pre-hybridization solution for 4 hours at 50⁰C, followed by treatment in hybridization solution with antisense or sense probe (3ng/ul) overnight at 55 0 C. Slides were washed with 2x, 1.5x and 0.2x SSC buffer, incubated with blocking solution for 1 hour at room temperature, incubated with 1:250 AP-conjugated anti-digoxingenin antibody over night at 4 o C, followed by NBT/BCIP incubation for 12 hours.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!