Mouse CCL5 cDNA was RT-PCR amplified with primers 5’ATGAAGATCTCTGCAGCTGCCC 3’ and 5’CTAGCTCATCTCCAAATAGT 3’ . PCR products were ligated to the pGEM-T vector (Promega) and sequenced. The pGEMT- plasmids were then linearized by restriction digest and gene-specific riboprobes were synthesized by in vitro transcription using a Maxiscript SP6/T7 kit (Ambion). Unincorporated nucleotides were removed using RNA Mini Quick Spin Columns (Roche). Paraffin embedded tissue specimens were pre-treated as described [22 (link)], following deparaffinization in xylene and rinsing in ethanol. In situ hybridization with 35S-labeled riboprobes was performed at 50°C overnight as described [22 (link)], with 0.1M dithiothreitol included in the hybridization mix. Tissue sections were coated with NTB emulsion (Kodak) and exposed at 10°C for 14 days. The sections were counterstained with Hematoxylin (Vector) and mounted with Permount (Fisher). Images were captured using a Nikon Eclipse E600 microscope, a Nikon DS-Ri1 camera, and Nikon NIS-Elements software.
Maxiscript sp6 t7 kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Maxiscript SP6/T7 kit is a laboratory tool used for in vitro transcription. The kit provides reagents and protocols for the synthesis of RNA from DNA templates using SP6 or T7 RNA polymerase.
Automatically generated - may contain errors
Lab products found in correlation
Dnase 1, by Thermo Fisher Scientific (4 mentions)
Irdye 680 streptavidin, by LI COR (2 mentions)
Lightshift chemiluminescent rna emsa kit, by Thermo Fisher Scientific (2 mentions)
Biotin labeling ntp mixture, by Roche (2 mentions)
Nucaway spin column, by Thermo Fisher Scientific (2 mentions)
Nylon membrane dot blots, by Roche (2 mentions)
Sybr gold staining, by Thermo Fisher Scientific (2 mentions)
Digoxigenin 11 dutp, by Roche (2 mentions)
Typhoon 8600 imager, by GE Healthcare (2 mentions)
α 32p atp, by PerkinElmer (2 mentions)
Northernmax kit, by Thermo Fisher Scientific (2 mentions)
Quick rna mini kit, by Zymo Research (2 mentions)
Hematoxylin, by Vector Laboratories (1 mentions)
Ntb emulsion, by Kodak (1 mentions)
Permount, by Thermo Fisher Scientific (1 mentions)
Eclipse e600 microscope, by Nikon (1 mentions)
Pgem t vector, by Promega (1 mentions)
Ds ri1 camera, by Nikon (1 mentions)
Gel extraction kit, by Qiagen (1 mentions)
Quantity one 1 d analysis software, by Bio-Rad (1 mentions)
8 protocols using maxiscript sp6 t7 kit
1
In Situ Hybridization of Mouse CCL5 cDNA
2
Biotin-Labeled RNA Probe EMSA Protocol
3
Riboprobe Synthesis and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The As-nlp-22 specific riboprobe was created using primers nlp22-3RACE2 and nlp22-5RACE for PCR as described above. Products were cloned and sequenced to confirm the fidelity of the sequence and to determine the orientation of the insert in the vector. The target sequences of the riboprobe are shown in Figure 3b . The constructs were linearized using restriction enzymes NotI and SpeI (New England Biolabs, Beverly, MA, USA). Linearized plasmids were used as a template to synthesize an antisense (experimental) and a sense (negative control) digoxigenin-labeled riboprobe (Maxiscript SP6/T7 kit; Ambion, Austin, TX, USA; digoxigenin-11-dUTP; Roche Applied Science, Indianapolis, IN, USA) as previously described [54 (link)]. To remove unincorporated nucleotides, the reactions were run through NucAway Spin Columns (Ambion). Probe integrity and concentration were determined by gel electrophoresis with Sybr Gold staining (Molecular Probes, Eugene, OR, USA) and nylon membrane dot blots (Roche Applied Science protocol).
4
RNA Blotting and In Situ Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We obtained 5 μg of total RNA using Quick-RNA Mini Kit (Zymo Research). RNA blot was performed using NorthernMax Kit (Ambion) following the manufacturer’s protocol. Single stranded RNA probe was generated by in vitro transcription with MaxIscript SP6/T7 kit (Ambion) with ATP [α-32P] (PerkinElmer) using full-length Mhrt779, Myh6 and Myh7 as the template and followed by digestion with DNase I (Ambion). Hybridization was performed at 65°C. The blot was washed and imaged by Phosphor storage scanning by Typhoon 8600 Imager (GE Healthcare). In situ hybridization experiments were performed as previously described3 (link),33 (link).
5
Probe Synthesis for In-Situ Hybridization
6
RNA Blotting and In Situ Hybridization
7
RNA Expression Analysis of pbggcs Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of the pbggcs gene was analyzed by RNase Protection Assay (RPA) as previously described [26 (link)]. Briefly, Alpha-32P UTP labeled riboprobes for the pbggcs and the β-tubulin genes were synthesized in vitro by antisense transcription using the T7 RNA polymerase (Maxiscript SP6/T7 Kit, Ambion). RPA’s were performed using the RPAIII system (Ambion, Austin, Texas) according to the manufacturer’s instructions. Riboprobes were hybridized with total RNA from the P. berghei pbggcs-oe or wild type parasites overnight at 42°C. The probe-RNA hybrids were resolved on denaturing 6% acrylamide gels, which were subsequently exposed to autoradiography films. Autoradiograms were scanned and analyzed using Quantity One 1-D Analysis Software (Bio-Rad, v. 4.4). The density of the pbggcs signal was normalized to the density of the β-tubulin signal. Density ratios of the normalized pbggcs signals were subsequently normalized to ANKA to estimate mRNA expression levels in the pbggcs-oe parasites.
8
Biotin-Labeled RNA Probe EMSA Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Biotin-labeled RNA probe was generated by in vitro transcription with MAXIscript SP6/T7 kit (Ambion) with biotin labeling NTP mixture (Roche) using linearized pDrive-Mhrt779 construct as the template and followed by digestion with DNase I (Ambion). The EMSA was performed by using the LightShift Chemiluminescent RNA EMSA Kit (Thermo Scientific). The labeled probe was incubated with appropriate amount of recombinant proteins in 10 μl in the 1 × binding buffer (10 mM HEPES-KOH, pH 7.3, 10 mM NaCl, 1 mM MgCl2, 1 mM DTT) with 5 μg tRNA carrier at room temperature for 30 min. The reactions were then loaded onto 1% 0.5 × TBE agarose gel and transferred to BrightStar-Plus positive charged membrane. The biotin-labeled probes were detected and quantified subsequently by IRDye 680 Streptavidin (Li-COR, 926–32231) using Odyssey Infrared Imaging System. The shifted signals were quantified and plotted against amount of the MBP, MBP-D1, MBP-D2 and MBP-D1D2 proteins using previously described method26 (link) with GraphPad Prism (GraphPad). The software facilitates the fitting of non-linear regression model and calculation of Kds (Dissociate Constant) based on the fitting curve. The errors and r-square (r2) were also generated from the fitting curve.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!