The largest database of trusted experimental protocols

Hotstar hifidelity taq polymerase kit

Manufactured by Qiagen

The HotStar HiFidelity Taq Polymerase kit is a high-fidelity DNA polymerase designed for accurate DNA amplification. The kit includes the HotStar HiFidelity Taq Polymerase enzyme, reaction buffer, and additional components necessary for PCR amplification.

Automatically generated - may contain errors

2 protocols using hotstar hifidelity taq polymerase kit

1

Bacterial Expression of Rat SREBP-1a

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bacterial expression plasmid pET28a-nSREBP-1a (1–403aa), driven by T7 promoter, was constructed by inserting the coding sequence of amino acids (aa) 1–403 of rat SREBP-1a into pET28a vector on the basis of pSREBP-1a (NCBI Reference Sequence: NP_001263636.1). The coding sequence was amplified by PCR from rat hepatocyte cDNA using HotStar HiFidelity Taq Polymerase kit (Qiagen). The forward primer (EcoRI sited added) was CCGGAATTCATGGACGAGCTACCCTTCGGT, and the reverse primer (XhoI sited added) was CCGCTCGAGTGTGCCTCCTCCACTGCCACAA. The PCR conditions were 95°C for 5 min, 35 cycles: 94°C 15 sec, 50°C 1 min, 68°C 2 min, last extension at 72°C for 10 min..
+ Open protocol
+ Expand
2

Extraction and Analysis of CACNA1C Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human lung tissue (8 donors) without overt disease, but not suitable for transplant, was obtained from the Life Alliance Organ Recovery Agency according to institutional review board guidelines regarding consent and de-identification of individual donors (demographic characteristics, see Table 1). Peripheral lung tissue was excised, chopped into ~ 5 mm fragments, and snap frozen in liquid N2. For preparation of total RNA, tissue was ground in a mortar and pestle under liquid N2 and the powder immediately extracted using E.Z.N.A. HP Total RNA Isolation Kit (Omega Bio-Tek, Norcross, GA). Total RNA was treated with DNase I and reverse transcribed using AMV First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA) with a primer specific in exon 50 of the CACNA1C transcript 3′ UTR (see Table 1 for primers sequences). cDNA was amplified by 35 cycles of PCR using Hotstar Hifidelity Taq polymerase kit (Qiagen, Valencia, CA) with primers specific for exons surrounding known spice sites (Table 2) and the PCR reactions cloned into pGEMTeasy. cDNA in random individual colonies was isolated and sequenced.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!