Total RNA was extracted from heart tissues of ICM patients and the control using RNA isolation plus reagent (Takara, Osaka, Japan). Then, the concentration and quality of total RNA were examined by Thermo Fisher NanoDrop, the PrimerScriptTM RT Master Mix (Takara, Osaka, Japan) was used to reversely transcript the RNA into cDNA.
Nanodrop
Manufactured by Takara Bio
Sourced in Japan, China
The NanoDrop is a spectrophotometer designed to measure the concentration and purity of small-volume samples of nucleic acids (DNA, RNA) and proteins. It utilizes a unique sample-retention technology that allows for measurements of samples as small as 0.5 μL, without the need for cuvettes or other sample accessories.
Automatically generated - may contain errors
Lab products found in correlation
Primerscript rt master mix, by Takara Bio (2 mentions)
Rna isolation plus reagent, by Takara Bio (2 mentions)
Reverse transcription kit, by Takara Bio (2 mentions)
Sybr green master mix kit, by Takara Bio (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Tbx21, by Thermo Fisher Scientific (1 mentions)
Il 17a, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase and oligo dt, by Takara Bio (1 mentions)
Ifn γ, by Thermo Fisher Scientific (1 mentions)
Taqman probe, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Toyobo (1 mentions)
5 protocols using nanodrop
1
RNA Extraction and cDNA Synthesis
2
Quantifying HOTAIR and miR-17-5p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The concentration and purity of RNA were measured by NanoDrop spectrophotometer, and then the RNA was reversely transcribed into cDNA using reverse transcription kit (Takara, Dalian, China). Then, 1 μg of cDNA in each group was then used as the template to amplify the target genes. qRT-PCR was conducted on ABI 7900 Fast Real-Time PCR System (Applied Biosystem, Foster City, CA, USA) with SYBR Green Master Mix kit (Takara, Otsu, Japan). The relative expressions of HOTAIR and miR-17-5p were calculated using the 2 −ΔΔCT method. The primer sequences are shown in Table 1 .
Primer Sequences Used for qPCR
| Name | Primer Sequences |
|---|---|
| HOTAIR | Forward: 5′- GGGTGGCTCACTCTTCTGGC −3′ |
| Reverse: 5′- TGGCCTTGCCCGGGCTTGTC −3′ | |
| miR-17-5p | Forward:5ʹ- GGGGCAAAGTGCTTACAGTG −3’ |
| Reverse:5′- GTGCGTGTCGTGGAGTCG −3′ | |
| U6 | Forward:5ʹ- GCTTCGGCAGCACATATACTAAAAT −3’ |
| Reverse:5ʹ- CGCTTCACGAATTTGCGTGTCAT −3’ | |
| STAT3 | Forward: 5ʹ- AGAGGCGGCAGCAGATAGC −3’ |
| Reverse: 5ʹ- TTGTTGGCGGGTCTGAAGTT −3’ | |
| GAPDH | Forward: 5ʹ- ACCACAGTCCATGCCATCAC −3’ |
| Reverse: 5ʹ- TCCACCACCCTGTTGCTGTA −3’ |
3
Transcriptional Profiling of Naive CD8+ T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CD44loCD5loLy6C−, CD44loCD5hiLy6C−, and CD44loCD5hiLy6C+ CD8+ TN cells were sorted from pulled spleens and LNs. RNA was isolated with NuleoZOL (Macherey-Nagel) and extracted RNA was measured by NanoDrop and 1 μg of RNA was reverse transcribed into cDNA with M-MLV reverse transcriptase and oligo dT (TAKARA), following manufacturer’s instructions. Real-time RT-PCR was performed with the TaqMan Gene Expression Master Mix using StepOnePlus Real-Time PCR System version 2.2.2 (Applied Biosystems). The following TaqMan probes (Applied Biosystems) were used: Rorc (Mm01261022), Il17a (Mm00439618), Irf4 (Mm0516431), Ifnγ (Mm01168134), Tbx21 (Mm0045960), Eomes (Mm01351984), and Rn18sRn45s (Mm03928990). The expression level was calculated as 2-DCT, where DCT is the difference between the CT values of the target gene and 18S.
4
Gene Expression Analysis of FmSPLs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the CTAB method [50 (link)]. RNA concentration was measured with NanoDrop, and first-strand cDNA was synthesized using a reverse transcription kit (Takara, Dalian, China). cDNA was diluted 10 times and used as the template. The data were normalized using the reference gene Fraxinus mandshurica α-tublin [1 (link), 51 (link)], Gene-specific primers for RT-qPCR analysis were listed in Additional file 1 . For fluorescence qPCR, a SYBR Green (TOYOBO) kit was used. PCR was performed in a 20 μL reaction volume containing 6.4 μL of sterile distilled water, 10 μL of THUNDERBIRD SYBR qPCR Mix, 0.6 μL each of upstream and downstream primers, 0.4 μL of 50 × ROX reference dye, and 2 μL of cDNA template. Fluorescence qPCR was performed on the Applied Biosystems 7500 Real-Time PCR System [1 (link)]. The reaction conditions were as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s and 60 °C for 34 s, 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. All reactions were repeated three times. The y = log2ΔCT(control)-log2ΔCT(treatment) algorithm was chosen for the expression pattern of the FmSPLs gene under different abiotic stresses and hormone induction. The y = 2−ΔΔCT algorithm was chosen for the expression pattern of FmSPLs in the physical state. All data were processed with SPSS 22.
5
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from heart tissues of ICM patients and the control using RNA isolation plus reagent (Takara, Osaka, Japan). Then the concentration and quality of total RNA were examined by Thermo Fisher NanoDrop, the PrimerScript TM RT Master Mix (Takara, Osaka, Japan) was used to reversely transcript the RNA into cDNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!