Rnaase free dnase 1

RNA of platelets was extracted using Trizol reagent (Invitrogen), quantified using a NanoDrop spectrophotometer and treated with RNAase-free DNase I (Invitrogen) as recommended by the manufacturer. For miRNA expression analysis, 0.5 μg RNA was added a polyA tail using miDETECT A Track™ miRNA qRT-PCR Starter kit (RiboBio, Guangzhou, China), and reverse transcribed with miDETECT A Track™ Uni-RT primer. Specific primers and SYBR green mix used to detect miRNAs were purchased from RiboBio Co., Ltd. The U6 endogenous control was used for normalization. For mRNA expression analysis, 0.5 μg RNA was reverse transcribed using a Superscript RT reagent kit (Takara). Specific primers for real-time PCR were listed in Table 2. β-actin was used for internal standard of mRNA quantification. The cycling conditions of mRNA qRT-PCR were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. Melting curve analysis was used for primers specificity detection.

Total RNA from the serum samples was extracted using TRIzol^®reagent (CoWin Biotech, CN), quantified using a NanoDrop spectrophotometer, and treated with RNAase-free DNase I (Invitrogen) as recommended by the manufacturer. For miRNA expression analysis, 0.5 μg RNA was added to a polyA tail using the miDETECT A Track™ miRNA qRT-PCR Starter kit (RiboBio, Guangzhou, China), and reverse transcribed with miDETECT A Track™ Uni-RT primer. Specific primers and SYBR Green mix used to detect miRNAs were purchased from RiboBio Co., Ltd. The U6 endogenous control was used for normalisation. For mRNA expression analysis, 0.5 μg RNA was reverse transcribed using a Superscript RT reagent kit (Takara). The specific primers used for real-time PCR are listed in Table 1. The PCR conditions were as follows: pre-denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 20 s, and extension at 72 °C for 10 s. GAPDH was used as an internal standard for mRNA quantification. Melting curve analysis was used to determine primer specificity.Table 1

Primer sequences used for reverse transcription-quantitative PCR

Gene	Forward primer (5′–3′)	Reverse primer (5′–3′)
miR-200a-3p	TAACACTGTCTGGTAAGGATGTAA	GGCCAACCGCGAGAAGATG
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT
mRNA-PRKACB	GTCACTCCTGCTTACGGACT	ATTACTCGGGGGAGGGTTCT
mRNA-GAPDH	AGTGCCAGCCTCGTCTCATA	TGAACTTGCCGTGGGTAGAG