Vegfa sirna

We purchased the PVT1 small interfering RNA (siRNA), VEGFA siRNA, miR-195 inhibitor, and their corresponding negative controls from GenePharma (Shanghai, China). Next, we mixed the cells in a 6-well plate (5 × 10⁵ cells per well). Following the manufacturer’s instructions, after the cell density reached 80%, the transfection reagent was mixed with Lipofectamine 2000 (Invitrogen) and added to the cells [36 (link)]. The mixture was incubated at room temperature for 30 min and subsequently transferred to a Petri dish. After transfection for 48 h using Lipofectamine 2000, the transfected cells were collected to assess the transfection efficiency by qRT-PCR. The sequences of primers for transfection were listed below: circPVT1 siRNA: 5ʹ-GCAAAUGAAAGCUACCAAUTT-3ʹ; scramble siRNA: 5ʹ-UUCUCCGAACGUGUCACGUTT-3ʹ; VEGFA siRNA: 5ʹ-CUGGAAUUUGAUAUUCAUUGA-3ʹ; scramble siRNA: 5ʹ-UUCUCCGAACGUGUCAC
GUTT-3ʹ; miR‑195 mimics sense, 5ʹ‑UAGCAGCA
CAGAAAUAUUGGC‑3ʹ; miR‑195 mimics antisense, 5ʹ‑CAAUAUUUCUGUGCUGCUAUU‑3ʹ; mimics negative control (miR‑NC) sense, 5ʹ‑UUC
UCCGAACGUGUCACGUTT‑3ʹ; miR‑NC antisense, 5ʹ‑ACGUGACACGUUCGGAGAATT‑3ʹ.

MiR-29b mimics and inhibitors (GenePharm Co., Ltd., Shanghai, China) were used to upregulate or downregulate miR-29b expression. Cells were transfected with VEGFA-siRNA (GenePharm), H19-shRNA (GenePharm), or miR-29b mimics, inhibitors, or controls (GenePharm) using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, United States) according to the manufacturer’s protocol. A scrambled oligonucleotide (GenePharm) served as a control. Changes in RNA expression were determined by qRT-PCR 24 h after transfection, and changes in protein expression were measured by western blotting 48 h after transfection.

OS cell lines (American Type Culture Collection, Manassas, VA, USA) were maintained in Dulbecco modified Eagle medium (DMEM, Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco), 100 U/mL penicillin (Sigma-Aldrich, Louis, MO, USA), and 100 μg/mL streptomycin (Sigma-Aldrich) in a humid incubator (Forma Scientific, Marietta, OH, USA) with 95% O₂ and 5% CO₂ at 37°C. OS cells were transfected 24 h after being seeded in 6-well plate at a concentration of 5 × 10⁵ cells. VEGFA siRNA, scramble siRNA, miR-1 mimic (100 nM), and control miRNA mimic (GenePharm, Shanghai, China) were transfected into OS cells using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. After 6 h, the culture medium was replaced with 2 mL DMEM containing 10% FBS and antibiotics. Cells were harvested for gene expression analysis 48 h after transfection.