Rotor gene q 2plex hrm thermocycler

The mRNA level of oxidative stress- and inflammatory-related genes were quantified by real-time PCR using SYBR Green chemistry (Qiagen) in a Rotor-Gene Q 2plex Hrm thermocycler (Qiagen) as detailed by Giannetto et al. [26 (link)]. cDNA samples diluted 25-fold were run in duplicate, and in each reaction, no template or minus reverse transcriptase controls were included. A five-point standard curve of a 5-fold dilution series (1:1 to 1:32) from pooled RNA [27 (link)] was used to determine the PCR efficiency. The geNorm software (http://medgen.ugent.be/~jvdesomp/genorm/) was used to calculate the normalization factor from the two most stable reference genes, Gadph and 36b4, to correct the raw target gene data. All sets of primers are listed in Table 2. PCR reactions were performed using the following parameters: 95 °C (15 min) followed by a two-step cycling of 95 °C (5 s) and combined annealing/extension at 60 °C (10 s) for 40 cycles. Melting curves analysis was used to confirm the specificity of each reaction.

Quantitative PCR (qPCR) was used to evaluate the mRNA levels of the putative genes associated with the taurine biosynthesis in BSF larvae and prepupae. Transcript levels of ado, cdo, csad, and gad were quantified using the QuantiTect SYBR^®Green PCR Kit (Qiagen), 1:20 diluted cDNA samples, and gene-specific qPCR primers (Table S2) with a Rotor-Gene Q 2 plex Hrm thermocycler (Qiagen). The amplification efficiency and the specificity of each reaction were evaluated as reported elsewhere [37 (link)]. For each reaction, six biological replicates were run in duplicate together with minus reverse transcriptase and no template controls. Raw data of target genes were corrected using the normalization factor calculated by the GeNorm Software from three suitable reference genes, elongation factor (ef1-α), 18s ribosomal RNA (18s rRNA), and 16s ribosomal RNA (16s rRNA), as described by [38 (link)].

Total RNA was extracted from cells using TRIsure reagent (Bioline, France) and assessed for RNA quality and quantity by 1% (w/v) agarose gel electrophoresis and NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Italy). After removing any potential genomic DNA contamination, cDNA synthesis was performed from 1 μg total RNA using the QuantiTect reverse transcription kit (Qiagen) following manufacturer’s instructions. The transcript levels of nrf2 were quantified by quantitative Polymerase Chain Reaction (qPCR) using the QuantiTect SYBR^®Green PCR Kit (Qiagen) in a Rotor-Gene Q2 plex Hrm thermocycler (Qiagen). cDNA samples (1:50 diluted) were amplified using gene-specific qPCR primers for target gene (nrf2F: TTTCAGCAGCATCCTCTCCA and nrf2R: AGCCTTCAATAGTCCCGTCC) and for reference genes (gadphF: TCCATGACAACTTTGGCATTG; gadphR: TCACGCCACAGCTTTCCA; 36b4F: GGACCCGAGAAGACCTCCTT; and 36b4R: GCACATCACTCAGAATTTCAATGG). Biological replicates (n = 6) were run in duplicate together with minus reverse transcriptase and no template controls for each reaction. PCR efficiency and specificity were evaluated as previously described [27 (link)]. The normalization factor calculated by the GeNorm Software from the two most stable reference genes (gadph and 36b4) was used to correct the raw data as reported by Nagasawa et al. [28 (link)].