Log In Sign up
The largest database of trusted experimental protocols

Nano glo dual luciferase assay

Manufactured by Promega
Visit Supplier

The Nano-Glo Dual Luciferase Assay is a lab equipment product developed by Promega. It is designed to measure the activity of two different luciferase reporter enzymes simultaneously in a single sample. The assay uses a NanoLuc luciferase and a firefly luciferase, which emit different wavelengths of light when activated. This allows for the quantification of two biological activities or processes in the same experiment.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions) On targetplus non targeting sirna, by Horizon Discovery (2 mentions) Bca assay, by Thermo Fisher Scientific (2 mentions) On targetplus human upf, by Horizon Discovery (2 mentions) Silencer select upf, by Horizon Discovery (2 mentions) Infinite 200 pro, by Promega (2 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions) Passive lysis buffer (plb), by Promega (1 mentions) Pgl4.53 pgk, by Promega (1 mentions) Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions) Viafect, by Promega (1 mentions) Pnl1.1 nluc, by Promega (1 mentions) Glomax 20 20 single tube luminometer, by Promega (1 mentions) Spectramax m3, by Promega (1 mentions) Dulbecco s modified eagle medium, by Corning (1 mentions) Pnl2.1 vector, by Promega (1 mentions)

8 protocols using nano glo dual luciferase assay

1

Bisphenol Exposure Dynamics in Placental Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Untreated placental 3A cells were trypsin digested and transferred into 6-well plates at low confluency (≤40%). After allowing the cells to adhere to the plate (14–18 hours), cells were transfected using a mixture of 600ng haplotype promoter plasmid DNA, 66ng firefly luciferase control plasmid pGL4.53 PGK (Promega, Madison, WI) and 2μL Lipofectamine 3000 transfection reagent (Invitrogen, Carlsbad, CA). After transfection, cells were allowed to recover for 36–48h and were then exposed to BPA, BPS or a mixture of both bisphenols dissolved in 3 × 10−5 % ethanol. For the initial acute exposures, the experiment was carried out for 90 minutes with samples taken at t=0, 15, 30, 45, 60 and 90 minutes. At each time point, cells were lysed with 500μL Passive Lysis Buffer (PLB, Promega, Madison WI) and the effects of acute exposure were measured using the NanoGlo Dual-Luciferase® Assay (Promega, Madison, WI). The maximal signal was observed for both bisphenols at 15 minutes. Therefore, for all subsequent acute exposures, samples were collected after 15 minutes.
Speidel J.T., Xu M, & Abdel-Rahman S.Z. (2018). Bisphenol A (BPA) and bisphenol S (BPS) alter the promoter activity of the ABCB1 gene encoding P-glycoprotein in the human placenta in a haplotype-dependent manner. Toxicology and applied pharmacology, 359, 47-54.
+ Open protocol
+ Expand
2

AR-Mediated Transcriptional Regulation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
AR reporter gene assay was performed with AR-negative PC-3 cells in 96-well plate format employing a synthetic promoter composed of two androgen responsive elements and a TATA-box ((ARE)2TATA) in framework of nanoluc reporter vector pNL1.1 [Nluc] (Promega). A PGK-promoter driven luciferase control vector (pGL4.53, Promega) was included for normalization. Per well, 30 ng of each, reporter and normalization control vector and 4 ng of AR-wild-type expression vector pSG5AR were mixed and complexed for 15 min with 0.2 μL of transfection reagent (Viafect, Promega) in 3 μL of transfection buffer and thereafter mixed with 50 μL of PC3 suspended in medium supplemented with 3% charcoal-stripped FCS (2×105 cells/mL). After an incubation for 30 min at room temperature cell suspension was transferred to the wells, R1881 (1 nM), enzalutamide (10 μM) and vehicle were added and cells were incubated for 36 h before NanoLuc and firefly luciferase activities were measured using Chameleon 5025 instrument (HVD Life Sciences) and Nano-Glo Dual-Luciferase Assay (Promega) according to manufacturer's recommendations. Quadruplicate samples were measured for each treatment and nanoluc reporter gene activity was normalized to control luciferase activity.
Hoefer J., Akbor M., Handle F., Ofer P., Puhr M., Parson W., Culig Z., Klocker H, & Heidegger I. (2016). Critical role of androgen receptor level in prostate cancer cell resistance to new generation antiandrogen enzalutamide. Oncotarget, 7(37), 59781-59794.
+ Open protocol
+ Expand
3

Investigating UPF1 Function in Dual Luciferase Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lipofectamine RNAiMAX (Invitrogen) was used to transfect siRNAs into HeLaFlp-In dual luciferase reporter cells. ON-TARGETplus human UPF1 pooled siRNAs or Silencer select UPF1 siRNA (s11926) and ON-TARGETplus Non-Targeting siRNA (GE Dharmacon) were transfected at 25nM 16 hours after the cells were seeded in 24-well plate. The reporter gene expression was induced by 2 μg/ml tetracycline at 48 h after transfection, and samples were collected after another 48 h. TransIT®-LT1 Transfection Reagent (Mirus) was used to transfect pcDNA3.1-Flag-UPF1. Cells were seeded 24 hours after transfection and induced by 2 μg/ml tetracycline for another 48h. Cells were lysis with 5X passive lysis buffer. Fluc and Nluc luciferase activities were measured by Nano-Glo Dual Luciferase Assay (Promega) on Tecan Infinite 200 PRO. NLuc levels were normalized to total protein or FLuc. Protein concentration was quantified by BCA Assay (ThermoFisher Scientific).
24 hours after splitting, HEK293T cells were transfected using Lipofectamine 3000 (Thermo Fisher Scientific). Experiments were performed 24 hours post-transfection. Expression of GFP and exogenous UPF1 was validated by qRT-PCR and Western Blot.
On day 13 of differentiation, iPSNs were transfected with 100nM siRNA by Lipofectamine RNAiMAX or transduced with lentivirus and then assayed at 30–32 days post-differentiation.
Zaepfel B.L., Zhang Z., Maulding K., Coyne A.N., Cheng W., Hayes L.R., Lloyd T.E., Sun S, & Rothstein J.D. (2021). UPF1 reduces C9orf72 HRE-induced neurotoxicity in the absence of nonsense-mediated decay dysfunction. Cell reports, 34(13), 108925.
+ Open protocol
+ Expand
4

FOXO3 3'-UTR Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA fragment of the FOXO3 (507 bp) 3’-UTR to encompass miR-221 predicted target site, was inserted into the XhoI-XbaI restriction sites in the multiple cloning site of the reporter vector pmiRNano-GLO (Promega). This bicistronic vector contains NanoLuc luciferase (NlucP) as the primary reporter gene and Firefly luciferase (Luc2) as control reporter for normalization. Primers used in the PCR were, Forward FOXO3 3’-UTR: CCGCTCGAGTCCCTGCTTGAGTTCTTGCTGAT, which contains the XhoI restriction site (CTCGAG), Reverse FOXO3 3’-UTR GCTCTAGATTCACTGCTACTGGAAAGT, which contains the XbaI restriction site (TCTAGA). IVD cells were transfected with 100 ng of reporter vector in combination with 30 nM of pre-miR-221 precursor (named miR-221 mimic), or Negative control (all purchased from Ambion Life Technologies), using Lipofectamine 2000 reagent (ThermoFisher). After 48 hours, transfected IVD cells underwent NanoLuc and Firefly luciferase activity measurements using the GloMax 20/20 single tube Luminometer (Promega) and the Nano-Glo Dual-Luciferase Assay (Promega) according to the manufacturer’s recommendations. The ratio NanoLuc reporter activity/Firefly control reporter activity was calculated for each well. For each IVD sample all transfections were performed in triplicate, and data were presented as mean values with standard deviation.
Penolazzi L., Lambertini E., Bergamin L.S., Roncada T., De Bonis P., Cavallo M, & Piva R. (2018). MicroRNA-221 silencing attenuates the degenerated phenotype of intervertebral disc cells. Aging (Albany NY), 10(8), 2001-2015.
+ Open protocol
+ Expand
5

Transient Transfection and Luciferase Assay in HEK293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells were grown in Dulbecco’s modified Eagle medium (Corning) containing 4.5 g/L glucose, L-glutamine, and sodium pyruvate supplemented with 10% (v/v) fetal bovine serum, 100 U/mL penicillin and 100 μg/mL streptomycin. Cells were passaged every other day at a density of 7.5 × 105 cells per 10-cm plate and maintained at 37 °C in a humidified incubator supplemented with 5% CO2.
Plasmid DNAs were transfected with Lipofectamine 3000 according to manufacturer’s protocol. For luciferase assays, HEK293 cells were seeded into 12-well plates and grown to 80% confluency and transfected the next day. Forty-eight hours after transfection, cells were washed with 1x PBS; 250 μl of 1x PBS was added to each well, and the plates were frozen at −20 °C for 2 h. Plates were thawed on ice, and Nluc and firefly luciferase (Fluc) activities were measured with the Nano-Glo Dual Luciferase Assay (Promega) on a SpectraMAX M3 according to manufacturer’s protocols. Nluc levels were normalized to Fluc.
Lampasona A., Almeida S, & Gao F.B. (2021). Translation of the Poly(GR) Frame in C9ORF72-ALS/FTD Is Regulated by Cis-Elements Involved in Alternative Splicing. Neurobiology of aging, 105, 327-332.
+ Open protocol
+ Expand
6

Luciferase Assay for Promoter Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
The MDK promoter (encompassing 1,063 bp upstream and 204 downstream of the Midkine starting site; NM_001012333; chr11+: 46358816‐46360083) and the Flt4 promoter (encompassing 1364 bp upstream and 19 downstream of the Flt4 starting site; NM_002020; chr5‐: 180009187‐180010570) were cloned into pNL2.1 vector (#N1061; Promega, MA). These reporter plasmids were transfected into SK‐Mel‐147 cells or HLEC. Cells were co‐transduced with pGL4.52‐Luc2 (#E1320; Promega) vector as transfection control. Luciferase activity was monitored 16 h thereafter (in the presence or absence of BO‐110) using the Nano‐Glo® Dual‐Luciferase assay (#N1610; Promega). Cell viability was kept over 80% in all conditions analyzed.
Olmeda D., Cerezo‐Wallis D., Mucientes C., Calvo T.G., Cañón E., Alonso‐Curbelo D., Ibarz N., Muñoz J., Rodriguez‐Peralto J.L., Ortiz‐Romero P., Ortega S, & Soengas M.S. (2021). Live imaging of neolymphangiogenesis identifies acute antimetastatic roles of dsRNA mimics. EMBO Molecular Medicine, 13(12), e12924.
+ Open protocol
+ Expand
7

Dual-Luciferase Assay for IRES Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
A dual-luciferase assay was performed 48 h post-transfection using the NanoGlo Dual Luciferase Assay (Promega) according to the manufacturer’s instructions for 96-well plates using multichannel pipettes. FLuc and NLuc activity was measured using a luminometer (Perkin Elmer Enspire II) 15 min post the addition of their respective substrates. Luminescence was normalised against the appropriate promoterless vector and the ratio of NLuc:FLuc was calculated. Using these values, the relative response ratios (RRR) were calculated where the ratio of NLuc:FLuc for the positive EMCV IRES control was set to a value of 1 and the ratio of NLuc:FLuc for the negative IRES control was set to a value of 0 using the following equation: RRR=experimentalratio-negativeIRESratiopositiveEMCVratio-negativeIRESratio
Statistical significance was assessed using a one-way ANOVA with a p-value < 0.05 suggesting statistical significance.
Grosz B.R., Svaren J., Perez-Siles G., Nicholson G.A, & Kennerson M.L. (2021). Revisiting the pathogenic mechanism of the GJB1 5’ UTR c.-103C > T mutation causing CMTX1. Neurogenetics, 22(3), 149-160.
+ Open protocol
+ Expand
8

Investigating UPF1 Function in Dual Luciferase Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lipofectamine RNAiMAX (Invitrogen) was used to transfect siRNAs into HeLaFlp-In dual luciferase reporter cells. ON-TARGETplus human UPF1 pooled siRNAs or Silencer select UPF1 siRNA (s11926) and ON-TARGETplus Non-Targeting siRNA (GE Dharmacon) were transfected at 25nM 16 hours after the cells were seeded in 24-well plate. The reporter gene expression was induced by 2 μg/ml tetracycline at 48 h after transfection, and samples were collected after another 48 h. TransIT®-LT1 Transfection Reagent (Mirus) was used to transfect pcDNA3.1-Flag-UPF1. Cells were seeded 24 hours after transfection and induced by 2 μg/ml tetracycline for another 48h. Cells were lysis with 5X passive lysis buffer. Fluc and Nluc luciferase activities were measured by Nano-Glo Dual Luciferase Assay (Promega) on Tecan Infinite 200 PRO. NLuc levels were normalized to total protein or FLuc. Protein concentration was quantified by BCA Assay (ThermoFisher Scientific).
24 hours after splitting, HEK293T cells were transfected using Lipofectamine 3000 (Thermo Fisher Scientific). Experiments were performed 24 hours post-transfection. Expression of GFP and exogenous UPF1 was validated by qRT-PCR and Western Blot.
On day 13 of differentiation, iPSNs were transfected with 100nM siRNA by Lipofectamine RNAiMAX or transduced with lentivirus and then assayed at 30–32 days post-differentiation.
Zaepfel B.L., Zhang Z., Maulding K., Coyne A.N., Cheng W., Hayes L.R., Lloyd T.E., Sun S, & Rothstein J.D. (2021). UPF1 reduces C9orf72 HRE-induced neurotoxicity in the absence of nonsense-mediated decay dysfunction. Cell reports, 34(13), 108925.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!