Hiscript 2 q select rt supermix for qpcr kit

Total RNA was isolated using the Trizol method. Reverse transcription was performed with the HiScript II Q Select RT SuperMix for qPCR kit (Vazyme, Nanjing, China). The cDNA was used as the template. The reactions were performed on a real-time PCR machine (ABI Step One Plus, Pleasanton, CA, USA). The GAPDH gene was used as the housekeeping gene. Gene relative expression was calculated by the 2^−ΔΔCT method [26 (link)]. The primer sequences of each gene are shown in Table 1.

Total DNA was isolated using a DNA extraction kit (Kangwei Century Biotechnology Co., Ltd., Beijing, China). The PCR test was conducted with transgenic plant DNA or wild type (WT) DNA as a template, the specific primers listed in Table S1, distilled water, and KOD-One ™ PCR MasterMix (Lot# 153100) from TOYOBO. The detailed program was as follows: 98°C, 5 min; 98°C, 10 s; 58.8°C, 15 s; 68°C, 1 min; 68°C, 5 min; 12°C, maintenance. Agarose gel electrophoresis with approximately 1.8% agarose gel was used to test the PCR products.
qRT-PCR was also conducted here. The total RNA was isolated from both WT and transgenic lines using an OminiPlant RNA Kit (Lot# CW2598S) according to the manufacturer’s instructions. The cDNA was synthesized in a two-step strategy using HiScript II Q Select RT SuperMix for qPCR kit (Cat# R232-01) from Vazyme, and 1 µg isolated total RNA was used as a template. qRT-PCR was performed using a ROCHE LightCycler 96 machine and AceQ qPCR SYBR Green Master Mix (Cat# Q111-02) kit from Vazyme according to the manufacturer’s instructions. The qRT-PCR analysis results were evaluated using 2^-ΔΔCT (Livak and Schmittgen, 2001 (link)). Each sample was subjected to three independent biological replicates. Actin 7 was used as an internal control. Table S1 lists all the primer sets designed in this study.

The throat swab specimens of caregivers were defrosted in a − 4 °C environment. Each 200 μl specimen was processed by using LogPure Viral RNA/DNA Kits (250 reactions) (Magen, Guangzhou, China). Lastly, 60 μl of viral RNA was extracted. Reverse transcription was conducted using a HiScript® II Q Select RT SuperMix for qPCR kit (Vazyme, Nanjing, China). The primers for enterovirus were designed on the basis of other literature [17 (link), 18 (link)]. Table 1 lists the details of the primers for enterovirus (Invitrogen Custom Primers, Shanghai). Next, 10 μl of 2 × qPCR mix (iQ™ SYBR® Green Supermix, Bio-Rad, America), 1 μl of forward primer, 1 μl of reverse primer, 1 μl of probe, 3 μl of tri-distilled water and 4 μl s of cDNA sample were added into each PCR tube. Afterwrad, Taqman real-time PCR was conducted with a quantitative fluorescence analyzer (Bio-rad CFX96, America). All experiments were performed in accordance with the manufacturer’s instruction. When the Ct value was greater than 20 or less than 40, corresponding specimens were considered positive.
Table 1

Primers for the enterovirus real-time fluorescence quantitative PCR

Primer Name	Sequence 5′-3’	3′ Label	5′ Label	Size(bp)
Forward primer	CCCTGAATGCGGCTAATCC
Reverse primer	ATTGTCACCATAAGCAGCCA
Probe	AACCGACTACTTTGGGTGTCCGTGTTTC	BHQ1	FAM	146

First, 0.1% Methyl Jasmonate (MeJA) was evenly sprayed onto the petals of Z. candida with consistent growth; 0.1% ethanol was used as the control treatment. Samples were collected at 2 and 4 h after treatment. RNA was extracted from the MeJA-treated and control samples using an RNA extraction kit and then reverse transcribed to cDNA using the HiScript II Q Select RT SuperMix for qPCR kit (Vazyme, Nanjing, China). Gene expression was quantified through the use of the SYBR Green qPCR Master Mix kit (Vazyme, Nanjing, China) and subsequent data analysis was accomplished through a relative quantitative approach and graphing utilizing GraphPad Prism 9 (https://www.graphpad.com/. 1 November 2023).

Total RNA from cultured cells or mouse tissues was extracted and dissolved in RNase‐free water. To determine the expression of miR‐29b‐2‐5p and miR‐34c‐3p, total RNA (500 ng) was reversely transcribed with HiScript^® II Q Select RT SuperMix for qPCR Kit, according to the manufacturer's instructions followed by real‐time PCR, using The AceQ^® qPCR SYBR^® Green Master Mix kit (Vazyme Biotech Co., Ltd.). MiRNA expression was normalized to endogenous U6 snRNA expression. To determine lncRNA‐ATB expression, reverse transcription was performed using HiScript^® II Q RT SuperMix for qPCR Kit (Vazyme Biotech Co., Ltd.). Next, the AceQ^® qPCR SYBR^® Green Master Mix kit was used for lncRNA‐ATB amplification. LncRNA‐ATB expression was normalized to GAPDH expression. All qPCR primers were designed by Genery Co., Ltd., and qRT‐PCR analysis was performed using LightCycer^®480II.

Total RNA was extracted using the RNAsimple Total RNA Extraction Kit (TIANGEN). The RNA sample was then reverse transcribed in a 20-μL volume using the HiScript II Q Select RT SuperMix for qPCR kit (Vazyme). SYBR Green quantitative PCR was performed to determine the relative expression levels of HR-related genes NtHIN1 and NtHsr203J, and NtEF1α was selected as an internal control. Quantification of the relative changes in gene transcript levels was performed using the 2^−ΔΔCt method (Livak and Schmittgen, 2001 (link)). The primers used for amplification were listed in Table S1.