Sensifast probe lo rox one step kit

The supernatant was collected, centrifuged in a tabletop centrifuge for 5 min at maximum speed and stored at −80 °C. RNA was extracted by using the Qiagen viral RNA extraction kit as per the manufacturer’s instructions. RNA load in the media was determined by quantitative real-time PCR. Real-time PCR was conducted with SensiFAST Probe Lo-ROX One-Step Kit (Bioline, 78005) and analyzed with the 7500 Real-Time PCR System (Applied Biosystems). The PFU equivalent per ml was calculated from the standard curve generated from virus stocks. Quantitative PCR primers and probes for the detection of SARS-CoV-2 N1 were obtained from IDT (2019-nCoV CDC EUA Kit, cat #10006606). Quantitative PCR primers and probes for the detection of PR8: PR8-PA-FW: CGGTCCAAATTCCTGCTGA; PR8-PA-RW:CATTGGGTTCCTTCCATCCA; PR8-PA-Probe: CCAAGTCATGAAGGAGAGGGAATACCGCT.

Lysed blood and total liver lobe homogenates were thawed and further diluted for a final concentration of 50 µL whole blood or 50 mg liver to 2 mL of lysis buffer, of which 1 mL of lysate was processed in duplicate by the Abbott m2000sp. using the mSample RNA preparation kit (Abbott Molecular). Extracted RNA were subject to Plasmodium 18S rRNA quantitative reverse transcription-PCR (qRT-PCR) using the SensiFAST™ Probe Lo-Rox One-Step Kit (Bioline #BIO-78005) as previously described [23 (link)] but with locked nucleic acid analogs [+_] on the Pan-Plasmodium primers (Forward PanDDT1043F19: AAAGTTA[+A]GGGA[+G][+T]GAAGA, Reverse PanDDT1197R22: AA[+G]ACTTTGATTTCTC[+A]TAAGG; Qiagen) in addition to a quencher modification on the P. falciparum probe (5′-[6-FAM]-ATTTATTCAGTAATCAAATTAGGAT-3′ [Black Hole Quencher 1 PLUS]; LGC BioSearch Technologies) to permit an increased annealing temperature of 54 °C for improved assay specificity. Each specimen was quality controlled with a TATA-Binding Protein mRNA RT-PCR, and each qRT-PCR run was monitored with well-characterized run controls consisting of human whole blood samples. Results were quantified using an Armored RNA calibrator standard that encodes the P. falciparum 18S rRNA (Asuragen).

Total RNA was isolated from mouse joint tissues or human synovial cells using an RNeasy kit (Qiagen), in accordance with the manufacturer’s instructions. Joint tissues were prepared at 10 days after K/BxN serum transfer as described previously (Kim and Chung, 2012 (link)). RNA was reverse transcribed into cDNA using M-MLV-RT reverse transcriptase (Promega Corp., Madison, WI) prior to quantitative real-time PCR analyses. Gene-specific PCR products were measured using a 7500 sequence detection system (Applied Biosystems, Inc, Foster City, CA), and the results for each cytokine were normalized against Gapdh expression. All primers and probes were synthesized by Applied Biosystems (Appendix 1—Key resource table) and were used with a SensiFAST Probe Lo-ROX One-Step Kit (Bioline, London, UK).

Ae. aegypti mosquitoes were initially field-collected as larvae in 2016 by the Los Angeles County Mosquito and Vector Control District and identified morphologically. Wild females were bloodfed in the laboratory and eggs were subsequently collected from the bloodfed females. Wild adults were killed and tested individually for Zika, dengue and chikungunya viruses by quantitative RT-PCR (qRT-PCR) using previously described primer sets and cycle parameters [50 (link)–52 (link)] with the SensiFAST Probe Lo-ROX One-Step kit (Bioline, Memphis, TN) on a ViiA 7 instrument (Thermo Fisher Scientific). After verifying all adults tested negative for those 3 viruses, eggs were hatched and used to generate a colony. The genotypic identity of selected individuals from the colony was confirmed by partial sequencing of the cytochrome B gene [53 (link)] and cross-referenced to the Ae. aegypti genome. Colony size was maximized by hatching eggs from multiple females at each generation to prevent genetic bottlenecking. All mosquito infections were performed with 4 to 7-day old 12^th-generation (F12) Ae. aegypti mosquitoes.