Total RNAs were extracted from CRC cell lines using SteadyPure Quick RNA Extraction Kit (Accurate Biology), and cDNAs were reversed by ABScript III RT Master Mix for qPCR with gDNA Remover (Abclonal) according to the manufacturer’s instructions. The primer sequences for RT-qPCR of each gene are listed in Supplementary Table 5 . RT-qPCR was conducted in triplicate with 2X Universal SYBR Green Fast qPCR Mix (Abclonal). RNA-seq libraries were obtained by the NEBNext Ultra Directional RNA Library Prep Kit (NEB) according to the manufacturer’s instructions for Illumina sequencing.
Steadypure quick rna extraction kit
Manufactured by Accurate Biology
Sourced in China
The SteadyPure Quick RNA Extraction Kit is a laboratory product designed to efficiently extract and purify high-quality RNA from a variety of biological samples. The kit utilizes a simple and streamlined protocol to isolate RNA, which can then be used for various downstream applications, such as gene expression analysis, reverse transcription, and more.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green premix pro taq hs qpcr kit, by Accurate Biology (4 mentions)
Evo m mlv mix kit with gdna clean for qpcr, by Accurate Biology (3 mentions)
Rox reference dye, by Accurate Biology (3 mentions)
Sybr green premix pro taq hs qpcr kit rox plus, by Accurate Biology (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Evo m mlv rt mix kit, by Accurate Biology (2 mentions)
Sybr green qpcr kit, by Accurate Biology (2 mentions)
Universal sybr green fast qpcr mix, by ABclonal (2 mentions)
Nebnext ultra directional rna library prep kit, by New England Biolabs (1 mentions)
Abscript 3 rt master mix, by ABclonal (1 mentions)
Gdna remover, by ABclonal (1 mentions)
Hifair 3 1st strand cdna synthesis supermix for rt qpcr, by Yeasen (1 mentions)
Hieff qpcr sybr green master mix high rox plus, by Yeasen (1 mentions)
Nanodrop lite spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Clonexpress 2 one step cloning kit, by Vazyme (1 mentions)
Mut express 2 fast mutagenesis kit v2, by Vazyme (1 mentions)
Hiscript 3 1st strand cdna synthesis kit, by Vazyme (1 mentions)
22 protocols using steadypure quick rna extraction kit
1
RNA Extraction and RT-qPCR for CRC Cell Lines
2
RNA Extraction, Reverse Transcription, and RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the procedures, like RNA extraction, reverse transcription, and RT-qPCR, were conducted as per the instructions of the kit. Firstly, the total RNA of cells was extracted using SteadyPure Quick RNA Extraction Kit (Accurate Biotechnology (Hunan) Co.,Ltd). Then, the RNA reverse transcription was performed utilizing Hifair III 1st Strand cDNA Synthesis SuperMix for RT-qPCR (Yeasen Biotechnology (Shanghai) Co.,Ltd). Finally, the Hieff qPCR SYBR Green Master Mix (High Rox Plus) (11203ES, YEASEN Biotech Co., Ltd, China) was used for RT-qPCR and the 2^-ΔΔCT method was applied to calculate the relative gene expression level. Supplementary Table 1
3
Cytokine Gene Expression Analysis in PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To examine IL‐10, TGF‐β1, and IL‐6 cytokine gene expression, total RNA was isolated from PBMCs using SteadyPure Quick RNA Extraction Kit (Accurate Biology) according to the manufacturer's instructions. Total RNA was quantified using a NanoDrop Lite spectrophotometer (Thermo Fisher Scientific). 1 µg of total RNA was reversely transcribed to produce cDNA using Evo M-MLV Mix Kit with gDNA Clean for qPCR (Accurate Biology) and then amplified using SYBR Green Premix Pro Taq HS qPCR Kit (Rox Plus) (Accurate Biology) following the manufacturer’s protocol. Real-time quantitative PCR was performed using QuantStudio™ 5 Real-Time PCR System (Applied Biosystems). Primer sequences of different genes were as follows: GAPDH forward, 5′- GTCTCCTCTGACTTCAACAGCG -3′; reverse, 5′- ACCACCCTGTTGCTGTAGCCAA -3′. IL-10 forward, 5′- TCAAGGCGCATGTGAACTCC -3′; reverse 5′- GATGTCAAACTCACTCATGGCT -3′. TGF‐β1 forward, 5′- CCCACAACGAAATCTATGAC -3′; reverse, 5′- CTGAGGTATCGCCAGGAA -3′. IL-6 forward, 5′- ACTCACCTCTTCAGAACGAATTG -3′; reverse 5′- CCATCTTTGGAAGGTTCAGGTTG -3′. IL-2 forward, 5′- CTCACCAGGATGCTCACATTTA -3′; reverse 5′- TCCAGAGGTTTGAGTTCTTCTTCT -3′. The relative mRNA level was normalized by the expression of GAPDH. The relative expression was determined by the 2−ΔΔCT method.
4
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instruction, total RNA was extracted using SteadyPure Quick RNA Extraction Kit (Accurate biology, China). Real-time polymerase chain reaction (RT-PCR) was performed on the Roche LightCycler® 480 II using gene-specific primers and Universal SYBR Green Master Mix (ABdonal, China). Relative mRNA ratio was used to analyze the data and GAPDH was used as the internal reference. The primer sequence was presented in Supplementary Table 1
5
Minigene Assay for Exon 44 of CUBN
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Vector pSPL3, known as the exon trapping vector, was carried out for minigene assay. Briefly, exon 44 of CUBN and its adjacent intron 43 and 44, was PCR-amplified using the following primers: forward 5′-accagaattctggagctcgagATTCATCTAT CAGAAACATGATATATT-3′ and reverse 5′-accagaattctggagctcgagCAATGAGAATAGATAAATGGTCTGGCA-3′. XhoI and NheI were chosen as restriction sites. The PCR products were inserted into the vector pSPL3 following the standard process with ClonExpress II one step cloning kit (C112, Vazyme). The mutant type was constructed according to the procedure by Mut Express II Fast Mutagenesis Kit V2 (C214, Vazyme). Wild-type and mutant types were transfected into HEK293T cells with lipofectamine 3000 (Life Technologies). RNA was harvested using the Steadypure Quick RNA Extraction Kit (AG21023, Accurate biology) at 24 h after transfection. Then cDNA synthesis was performed with HiScript III 1st strand cDNA Synthesis Kit (R312, Vazyme). Subsequently, cDNA was PCR-amplified using the following pSPL3 specific primers:SD6-5′-TCTGAGTCACCTGGACAACC-3′ and SA2-5′-ATCTCAGTGGTATTTGTGAGC- 3′. The PCR fragments were identified by Sanger sequencing to evaluate the alternative splicing.
6
Comparative Analysis of SNX7 Expression in Liver Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human normal liver cell line (LO2) and human liver cancer cell lines (HuH-1, HuH-7 and HepG2) were purchased from Hongshun Biotechnology Co. LTD (Shanghai, China). LO2 cells were cultured in DMEM (Gibco, CA, USA) supplemented with 20%FBS (Procell, Wuhan, China). HuH-1, HuH-7 and HepG2 cells were cultured in RPMI-1640 (Gibco, CA, USA) supplemented with 10%FBS. All cells were maintained in a 5% CO2 incubator humidified at 37℃.
Total RNA was isolated from the cells using the SteadyPure Quick RNA Extraction Kit (Accurate Biology, AG21023, China) according to the manufacturer’s manual. cDNA was synthesized by GoScript™ Reverse Transcription System (A5001, Promega). qPCR was performed using the GoTaq® Master Mix (A6001, Promega) was used for qPCR. Primers for SNX7 were synthesized by Shangya Biotechnology (Fuzhou, China) with the following sequences: forward: 5ʹ-GCCCTGAAAGCAGATTGGGAG-3ʹ, reverse: 5ʹ- AGGCTTCTTCCAAGTGAAGGT-3ʹ. The 2−ΔΔCT method was used to calculate the relative expression levels of SNX7 with GAPDH as a reference gene.
Total RNA was isolated from the cells using the SteadyPure Quick RNA Extraction Kit (Accurate Biology, AG21023, China) according to the manufacturer’s manual. cDNA was synthesized by GoScript™ Reverse Transcription System (A5001, Promega). qPCR was performed using the GoTaq® Master Mix (A6001, Promega) was used for qPCR. Primers for SNX7 were synthesized by Shangya Biotechnology (Fuzhou, China) with the following sequences: forward: 5ʹ-GCCCTGAAAGCAGATTGGGAG-3ʹ, reverse: 5ʹ- AGGCTTCTTCCAAGTGAAGGT-3ʹ. The 2−ΔΔCT method was used to calculate the relative expression levels of SNX7 with GAPDH as a reference gene.
7
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using SteadyPure quick RNA extraction kit (Accurate Biology, China) and diluted in RNAase free water. One μg of RNA was reverse transcribed to cDNA using HiFiScript gDNA removal RT MasterMix (CW BIO, China). qPCR was performed using the SYBR Green Mix (Bio-Rad, USA) in a BioRad CFX96 Thermal Cycler (Bio-Rad, USA). Housekeeping gene GAPDH was used to normalize mRNA levels between different samples. Primer sequences are listed in Additional file 1 : Table S2.
8
qRT-PCR Analysis of Metabolic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells or tissues was extracted using the SteadyPure Quick RNA Extraction Kit (Accurate Biology, Hunan, China). The concentration and purity of the extracted RNA samples were determined. Afterwards, the extracted RNA was reverse-transcribed into cDNA using RT Master Mix for qPCR II (MedChemExpress, USA). Subsequently, qRT-PCR reactions were performed using SYBR Green qPCR Master Mix (MedChemExpress, USA) and the CFX96 RT-PCR system (Bio-Rad, USA). Finally, quantitative data analysis was conducted using the 2−ΔΔCt method. Primer sequences are listed in Table 1 .
Sequences of Primers Used for the qRT-PCR
| Genes | Forward (5′- 3′) | Reverse (5′- 3′) |
|---|---|---|
| β-actin | CATCCGTAAAGACCTCTATGCCAAC | ATGGAGCCACCGATCCACA |
| Slc25a1 | AGATGAACGAGCGAACCCAC | GATGGAGCCGTAGAGCAAGG |
| Acly | TAGGACAGCATCTTTTTCTGAGT | GACTTGGGACTGAATCTTGGG |
| HIF-1α | CTTTACCAACTCAAAACAGTCCC | CAGGGTGGGCAGAACATTTA |
| Hk2 | CGGAGTTGTTCTGCTTTGGA | TCACTGGGTCACTAAGGCTC |
| Pfkfb3 | GCCTCTTGACCCTGATAAATGTG | ATTCGGCTCTGGATGTGGT |
| Pkm2 | AAACAGCCAAGGGGGACTAC | AACAGCAGACGGTGGAACAT |
9
Quantitative Analysis of RNA Sequences
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA sequence analysis results were verified through q-PCR. A SteadyPure Quick RNA Extraction Kit (Accurate Biotechnology, Hunan, China) was used to extract total RNA, and then, the Evo M-MLV RT Mix Kit with gDNA Clean for qPCR (also from Accurate Biotechnology) was used to reverse transcribe the RNA into cDNA for quantitative polymerase chain reaction. A 2 µL template was then amplified by PCR (Servicebio, Wuhan, China) using primers (Supplementary Table S1 ) in a reaction volume of 20 μL, including 250 nM of each primer (forward and reverse), 10 µL of the SYBR Green Premix Pro Taq HS qPCR Kit (Rox Plus) (Accurate Biotechnology, Hunan, China), and 20 ng of cDNA. The reactions were performed using a 7,500 Fast Real-Time PCR Detection System (Applied Biosystems, United States) under the following conditions: 95°C for 30 s followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. The ratios (IoN-CCI mRNA levels to sham mRNA levels) were calculated using the Ct method (2−ΔΔCT) by normalizing all data to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
10
Quantification of Cell Death Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using the Steady Pure Quick RNA extraction kit (Accurate Biotechnology, AG21023). The isolated RNA was reverse-transcribed into complementary DNA using the Evo Moloney-murine leukemia virus reverse transcription premix kit (Accurate Biotechnology, AG11728). qRT-PCR was performed in a LightCycler (Roche, Germany) with 2× Universal SYBR Green Fast qPCR Mix (Abclonal, RK21203). The mRNA expression of LPCAT1 was calculated using the 2−ΔΔCt method. The primer sequences are shown in Table S2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!