Rnase a

Treated EA.hy926 cells on 6-well plates were harvested with trypsin (Catalog #: 25200114, Gibco™, Waltham, MA, USA) for cell cycle analysis using flow cytometry as previously described [46 (link)]. Briefly, after aspirating culture media, trypsinized cells were centrifuged at 750× g for 5 min and then washed once with PBS prior to ethanol fixation (5 mL of ice-cold 75% ethanol in PBS per well for 2 h). The ethanol was removed via centrifugation (300× g for 5 min), and the cell pellets were washed once with cold PBS before being resuspended in 0.5 mL PI solution (50 μg/mL PI (Catalog #: P4864, Sigma-Aldrich, St. Louis, MO, USA), 4 mM Na citrate, 0.1% Triton X-100, 50 μg/mL RNase A (Catalog #: T3018L, New England Biolabs, Ipswich, MA, USA), pH adjusted with NaOH to 7.8). The cells were incubated in the dark for 10 min at 37 °C, and 50 μL of 1.38 M NaCl was added to the 0.5 mL solution in each tube immediately after incubation. The samples were carefully pipetted to achieve a single cell suspension and then analyzed by flow cytometry (CytoFlex LX Digital Flow Cytometry Analyzer 4 Laser System (Beckman Coulter, Brea, CA, USA)) at the University of Manitoba Flow Cytometry Core Facility. On average, >15,000 gated events were analyzed to obtain the percentage of cells in sub G0/G1, G0/G1, S and G2/M phases of cell cycle based on the mean fluorescent intensity of PI.

Twenty-four hours post-electroporation cells were washed in 1 × PBS and harvested. Total RNA was extracted from all surviving cells using a Qiagen RNeasy maxi prep kit (QIAGEN, 75162), eluted with 1.5 mL nuclease-free water (Ambion, AM9938). The poly(A)-positive RNA was isolated using a Dynabeads mRNA Purification Kit (Life Technologies, 61006) following the manufacturer’s instructions. Then the mRNA was treated with TURBO DNase (Life Technologies, AM1907) for 30 minutes at 37 °C, followed by DNase inactivation and purification according to the kit protocol. Finally, the purified mRNA was quantified by NanoDrop 2000.
First strand cDNA synthesis was performed with SuperScript® III First-Strand Synthesis SuperMix (Life Technologies, 18080400) using a reporter RNA specific primer (5′ CAAACTCATCAATGTATCTTATCATG) and 450–500 ng mRNA per reaction for a total of 30 reactions. Five reactions were pooled (100 μL) and incubated at 37 °C for 1 h after adding 1 μL of 10 mg/mL RNaseA and 1 μL RNaseH (NEB, M0297).

Plasmid topoisomers were analyzed for the relaxation of superhelical turns using agarose-chloroquine gel electrophoresis in 1.75% agarose gels run in 40 mM Tris, 50 mM potassium acetate, 1mM EDTA, pH 8.3, containing sufficient chloroquine to resolve individual topoisomers. Transcription reactions were performed basically as described [20 (link)] using T7 or SP6 RNA polymerases (New England Biolabs, Ipswich, MA, USA) in RNAPol buffer supplemented with 0.5 mM ATP, UTP, GTP, and CTP, 40 mM KCl and 20 µg/mL RNaseA, for 1–2 hr at 37 or 40 °C. Samples were precipitated with two volumes of ethanol and redissolved and digested with RNaseA H (New England Biolabs, Ipswich, MA, USA) as recommended.

Spreads were prepared as previously described [30] (link). Briefly, confluent cells were incubated with 0.05 μg/mL colcemid (Gibco/Invitrogen) for 1 hour and swelled in hypotonic buffer (1∶1∶1 v/v/v 75 mM KCl: 0.8% Na citrate: H₂O) for 10 minutes. The cell concentration for extended or elongated chromosomes was 3.5×10⁴ cells/mL. Swelled cells were subject to centrifugation onto slides using a Shandon Cytospin 4. Chromosomes were fixed in 4% PFA in PBS and extracted in PBS+0.1% Tween 20 before incubation with antibody solution overnight at 4°C. For RNase A/H treatments, slides were treated with 100 μg/mL RNase A and RNase H (NEB) at 37°C for 20 minutes prior to incubation with antibody solution.

Cell-cycle progression was evaluated with a propidium iodide (PI) solution (MilliporeSigma, Burlington, Massachusetts, USA). Briefly, 5 x 10⁶ cells were collected by centrifugation at 300 x g for 5 min, washed in 1 mL PBS buffer containing 2% FBS, and resuspended in 5 mL chilled 70% ethanol dropwise and kept at 4°C. After a 24-hour incubation, fixed cells were centrifuged at 850 x g for 10 min, PBS-washed, and resuspended in a staining mixture of 1 mL PI staining solution + 50 µL RNase A (New England Biolabs, Whitby, Ontario, Canada) at 4°C overnight. Samples were then analyzed by flow cytometry at Ex/Em: 536/617 nm using the FlowJo software (Version 10.7, Tree Star, Inc., Ashland, OR., USA).