γ 32p datp

To generate the heteroduplex substrates we first labelled the top strand with [γ-³²P]dATP (Perkin Elmer) and T4 kinase (New England Biolabs). For the annealing reaction, the labelled oligonucleotide was mixed with the corresponding complementary strand and boiled for 5 min in a 1l beaker, then the water was left to cool down to <30°C. All labelled substrates were purified using illustra Microspin G50 columns (GE Healthcare).
EMSAs were performed as described in [58 (link)]. Briefly, 30 fmol of labelled DNA substrate was incubated with protein in a 20μl reaction containing 10mM Hepes-KOH (pH 7.5), 10 mM KCl, 3.3 mM MgCl2, 1 mM EDTA, 2.5 mM DTT, and 400 ng poly(dI-dC) (Sigma). For His-Rep68, 100 ng of protein was used and the reaction was set up using 15 mM NaCl. For the His-TrwC/Rep chimeric protein, the best conditions were 200 ng of protein and 75 mM NaCl. Cold competitor at 10 to 90-fold excess was added to the reactions where appropriate. After incubation for 20 min at room temperature, samples were spun down and 3 μl of loading buffer (0.25X TBE, 40% sucrose, 1% bromopheonol blue, 1% xylene cyanol) was added. The reactions were analysed on a native 6% polyacrylamide gel in 0.25X TBE. After the run, gels were treated as for the DNA helicase assay.

ChIP was performed using standard procedures and antibodies listed in Supplementary Table S1. A detailed protocol is provided in Supplementary Methods. Purified DNA recovered by ChIP was denatured in 0.2 M NaOH by heating to 100°C for 10 min and spotted onto a positively charged Biodyne B nylon membrane (Pall, VWR) before hybridization with a digoxigenin-labeled telomeric C-rich oligonucleotide (CCCTAA)₄TTA prepared using 3′-end labeling kit (Roche). Signal was revealed using the anti-digoxigenin-alkaline phosphatase antibodies (Roche) and CDP-Star (Roche), and images were captured using the Luminescent image analyzer LAS-4000 mini (GE Healthcare). Centromeric probe with sequence: 5′-CTTCGTTGGAAACGGGA (forward strand of the CenP Box) was used as a control. The primer was polyacrylamide gel electrophoresis purified and end-labeled with [γ³²P]dATP (PerkinElmer) using PNK followed by purification on G-25 column.

sAvL1-451 DNA were 5′-end-labeled with [γ−32P]dATP (PerkinElmer) using T4 polynucleotide kinase (NEB) and purified from excess of radioactive nucleotides using Oligo Clean & Concentrator kit (Zymo Research) following the manufacturer’s protocols. Binding reactions were set up in 10 µl total volume in a buffer with final concentrations 100 mM KCl, 10 mM Tris, pH7.4, 0.1 mM EDTA, 0.1 mM DTT, supplied with 500 ng LightShift^™ Poly (dI-dC) (Thermo Scientific). Addition of 2.5 µl of AvMBD proteins provided 5% glycerol per reaction. Proteins were first pre-incubated with non-radioactive DNA for 15 min at RT. Then, ³²P-labeled DNA was added to a final concentration of 0.05 nM, and reactions were incubated for additional 30 min at RT. After supplying with 6× EMSA gel-loading solution (Thermo Scientific), samples were loaded onto 6% DNA Retardation gels. Samples were run at 90 V in 0.5× TBE buffer (44.5 mM Tris–HCl, pH 8.3, 44.5 mM boric acid and 1 mM EDTA) at 4 °C for 90 min. Gels were dried using Model 583 Gel Dryer (BioRad), exposed with phosphorimaging plate (Fujifilm), scanned on Typhoon FLA 7000, and analyzed using Image Quant TL v8.1 software.

EMSAs were performed according to established protocols (42 (link)). Briefly, primers were designed to amplify the promoter regions of the S. mutansmntH gene (Table 4). The resulting amplicons were subjected to end labeling with [γ-³²P]dATP (Perkin-Elmer) in the presence of T4 polynucleotide kinase (New England BioLabs), after which they were centrifuged through a TE Select-D G-25 spin column (Roche Applied Science) to remove unincorporated [³²P]dATP. Binding reactions were prepared using 16-μl reaction mixtures containing 1 μl (∼13.25 ng) of end-labeled amplicon, purified native SloR protein at concentrations ranging from 0 to 400 nM, and 3.2 μl of 5× binding buffer (42 mM NaH₂PO₄, 58 mM Na₂HPO₄, 250 mM NaCl, 25 mM MgCl₂, 50 mg ml⁻¹ bovine serum albumin, 1 mg sonicated salmon sperm DNA, 50% glycerol, 37.5 M MnCl₂). Samples were loaded onto 12% nondenaturing polyacrylamide gels and resolved at 300 V for 1.5 h. Gels were exposed to Kodak BioMax film for 24 h at 80°C in the presence of an intensifying screen prior to autoradiography.

Nuclear extracts were obtained from 293FT cells transduced with the pLVSIN/CMV/flag-X/IRES/mCherry vectors using Nuclear/Cytosol Fractionation Kit (BioVision). The sense sequence of the oligonucleotide probe containing the MLV-PBS sequence (undermined) is 5′- TTTGGGGGCTCGTCCGGGATTT -3’.
Double-stranded probes were prepared by annealing the sense and the antisense single-stranded oligonucleotides, end-labeled with [γ-32P]dATP (PerkinElmer) using T4 polynucleotide kinase (New England Biolabs), and purified with MicroSpin G-25 Columns (GE Healthcare). Ten microliters of nuclear extracts were mixed with 20 μL binding buffer (100 mM HEPES pH7.9, 250 mM KCL, 5 mM EDTA, 5 mM dithiothreitol, 15 mM MgCl2, 5% glycerol) containing 3 μL FCS, 2 μL poly (dI/dC) (Sigma-Aldrich) and incubated for 20 min at room temperature. One microliter of the purified probes was added in the reaction mix and incubated for 20 min at room temperature. The anti-FLAG monoclonal antibody (F1804, Sigma-Aldrich) or the anti-KAP1 monoclonal antibody (ab22553, Abcam) was added for super-shift. Excessive cold probes were added as competitor. The samples were electrophoresed on 5% native acrylamide gels, dried, and visualized with a BAS phosphor screen.