Te2000 s microscope

ING2 MISSION® esiRNA (EMU022101) and negative control EGFP MISSION® esiRNA (EHUEGFP) were purchased from Sigma-Aldrich Inc. (St. Louis, MO, USA), which possessed the intellectual property to design and prepare the MISSION esiRNA. The Ing2 cDNA target sequence is as follows: 5′-AAACGCCTACAGCAGCATCTCCAGAGAGCGTTAATCAATAGCCAAGAATTGGGAGATGAAAAAATTCAGATTGTCACCCAGATGCTCGAATTGGTGGAGAACCGAGCGAGACAAATGGAGCTGCATTCACAGTGTTTCCAGGATCCTGCTGAAAGTGAGCGAGCCTCAGACAAGTCGAAGATGGATTCCAGTCAACCGGAAAGATCTTCTAGAAGACCTCGAAGACAGAGGACCAGTGAGAGCCGTGACTTATGTCACATGACAAACGGGATTGACGACTGTGATGATCAACCACCGAAAGAAAAGAGATCCAAGTCCGCCAAGAAGAAGAAGCGCTCCAAGGCCAAGCAGGAGAGGGAGGCATCCCCTGTCGAGTTTGCCATCGATCCCAATGAGCCCACCTACTGCTTGTGTAACCAAGTGTCCTACGGGGAGATGATAGGCTG-3′. MISSION esiRNA are a heterogeneous mixture of siRNAs that all target the same mRNA sequence. These multiple silencing triggers lead to lower off-target effects than single or pooled siRNAs, and exert highly specific and effective gene silencing. The concentration of ING2 MISSION esiRNA was 200 ng/μl in nuclease-free TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA). Approximately 10 pl of individual esiRNA was microinjected into the cytoplasm of the zygotes, which were cultured in CZB medium and subjected to further observation. The developmental progress of each group was observed and analyzed using a Nikon TE2000-S microscope.

For time-lapse studies, PANC1 cells stably expressing GFP-histone H2B were used as previously described.¹⁰ (link) Briefly, cells were seeded into 12-well plates and incubated for 24 hours. Pixantrone at various concentrations was then added to cells immediately before time-lapse videomicroscopy was commenced. The multi-well plate was placed into a heated chamber and bright-field and fluorescent images were taken every 5 minutes for up to 48 hours, using a Nikon TE2000S microscope (Nikon) controlled by Metamorph (Molecular Devices). To quantify the fates of cells for each condition, movies were examined frame by frame, and at least 100 cells were counted, from a 2 independent movies. Selected frames were chosen for montages to highlight cells undergoing aberrant mitosis.

Day 1 adult N2 worms were transferred to a slide containing 3 to 5 µL islands of solutions of high viscosity 3% hydroxypropylmethylcellulose (HPMC, Ashland Benecel K200M) in NGMB, surrounded by NGMB without HPMC. A second slide, spaced by 125 µm thick plastic spacers, was placed on top to form a two-dimensional chamber similar to those used for optogenetics experiments, but with an inhomogeneous mechanical environment. We imaged each slide under dark field illumination on a Nikon TE2000-S microscope and recorded worms transitioning from low-viscosity to high-viscosity regions.