Pgl3 luc vector

The wild‐type (wt) or mutant (mut) 3′‐UTR of human PIK3R1 containing potential binding sites for miR‐155 as predicted by the TargetScanHuman 7.2 (http://www.targetscan.org/vert_72/) was inserted into the pGL3‑luc vector (Promega: Madison, WI, USA) to obtain reporter plasmid. Primary chondrocytes were seeded in 96‐well plates and then cotransfected the reporter plasmid with miR‐155 mimic or miR‐155 inhibitor using Lipofectamine 3000 (Invitrogen). The negative control (NC) mimic and inhibitor were used as controls. At 36 hours after transfection, the luciferase activity was measured by a Dual‐Luciferase Reporter Assay System (Promega: Madison, WI, USA) according to the manufacturer's instructions. The ratio of firefly and Renilla luciferase activities in each well was calculated. Each treatment was performed in 5 replicates.

Pp53-TA-Luc plasmid (D2223, Beyotime), including multiple p53 response elements (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTTGGACATGCCCGGGCTGTC), was obtained from Beyotime Biotechnology (Shanghai, China). However, the promoter region of CDC6 (−1066~+240bp) was introduced into pGL3-Luc vector (Promega Corporation). HCT116 cells grown on 12-well plates were co-transfected with 0.4 μg pGL3-CDC6-Luc and pGL3-P53RE-Luc, which encodes firefly luciferase, 0.12 ng of the control plasmid Renilla luciferase vector, and the plasmids expressing Flag-YY1, YY1K183R, or Flag-MOF using PEI reagent. Total effector plasmids in each transfection were adjusted to 0.8 μg with empty vectors. Around 48 h after transfection, the luciferase activities of p53-Luc and pGL3-CDC6-Luc were measured using the Dual-Luciferase Reporter assay kit (Promega, Madison, WI, USA), and the renilla luciferase activity was used as the control for normalization.

The constructs pLXSN empty, pLXSN-16E6E7, pLXSN-HPV16E6, pLXSN-HPV16E7 and pLXSN-HPV18E6E7 were obtained from M.Tommasino (IARC, Lyon, France) (6). The pGL3 Luc vector was purchased from Promega. The constructs The full-length IL-1β-Luc, LILRE (IL-1 response element) and mutants were obtained from Philip E.Auron (University of Pittsburgh, Pittsburgh, PA 15261, USA). IL-1β deletions were cloned using the primers listed in Table 1. Nine E6 mutations were obtained from Dr Gilles Trave (CNRS, Illkirch, France); and previously described. These mutations were cloned into the pX5 plasmid. The retroviral pBabe-puro encoding HPV16 and 6 E6 and or E7 have been previously described [41 (link)]. The constructs pLXSN-HPV16 E6, HPV18 and HPV38 E6 and HPV6 E6 were a gift from D. Galloway (Fred Hutchinson Cancer Research Center, Seattle, WA). The plasmids used for HPV16 structural genes and control PsV production, the target HPV16 genome, and GFP (for PsV control) were kindly donated from the laboratories of Martin Muller and Angel Alonso (DKFZ, Germany). pUNO, human IRF6 and IRF8 constructs were purchased from Invivogen. The p53 plasmid was obtained from Addgene. siRNA for 16E6E7 and E6 was purchased from Dharmacon and Sigma respectively. siRNA for E6AP [42 (link)]CRISPR for p53 was purchased from Santa Cruz.

The promoter region of YY1 (−97 bp to +203 bp) and CDC6 (−1066–+240 bp) was introduced into the pGL3-Luc Vector (Promega Corporation). The luciferase reporter assay was conducted as described previously [59 (link)]. Briefly, 293T cells were co-transfected with 0.4 μg pGL3-CDC6-Luc or pGL4-YY1-Luc plasmid, which encodes firefly luciferase, 0.012 ng renilla luciferase vector, and the plasmids expressing Flag-MOF/Flag-NSL3 using PEI reagent. After 24 h or 48 h of transfection, the luciferase activities were measured using the Dual-Luciferase Reporter assay kit (Promega, Madison, WI, USA). The renilla luciferase activity was used as the control for normalization.

A FBXW7-3’UTR luciferase reporter was created. Briefly, the 3’UTR sequence of FBXW7 predicted to interact with miR-223 was amplified and cloned into the EcoRI and XhoI sites of pGL3-luc vector (Promega, Madison, WI, USA). The site-directed mutagenesis of the miR-223 target-site was carried out using Invitrogen (Californlia, USA). The constructs were sequenced and named pGL3-luc-FBXW7/3’-UTR-wt or pGL3-luc-FBXW7/3’-UTR-mut. For reporter assays, SGC-7901 cells were cultured in 24-well plates and each transfected with 100 ng of pGL3-luc-FBXW7/3’UTR-wt or pGL3-luc-FBXW7/3’UTR-mut and miR-223 mimics or inhibitor using Lipofectamine 2000 (Invitrogen, USA). 48 hours after transfection, cells were harvested and assayed with Dual-Luciferase Reporter Assay kit (Promega, USA) according to the manufacturer’s instructions.

A FBXW7-3′UTR luciferase reporter was created. Briefly, the 3′UTR sequence of FBXW7 predicted to interact with miR-223 was amplified and cloned into the EcoRI and XhoI sites of pGL3-luc vector (Promega, USA). The site-directed mutagenesis of the miR-223 target-site was carried out using Invitrogen (Californlia, USA). The constructs were sequenced and named pGL3-luc-FBXW7/3′-UTR-wt or pGL3-luc-FBXW7/3′-UTR-mut. For reporter assays, PADC cells were cultured in 24-well plates and each transfected with 100 ng of pGL3-luc-FBXW7/3′UTR-wt or pGL3-luc-FBXW7/3′UTR-mut and miR-223 mimics or inhibitor using Lipofectamine 2000 (Invitrogen, USA). 48 hours after transfection, cells were harvested and assayed with Dual-Luciferase Reporter Assay kit (Promega, USA) according to the manufacturer's instructions.