Modified GP genes were cloned into the pcDNA3.1+ mammalian expression vector and transfected into HEK 293T cells at 50–80% confluency using JetPRIME transfection reagent (Polyplus transfection, New York, NY). Modified GP genes were also cloned into pFastBac™1 (ThermoFisher Scientific, Waltham, MA), a transposing vector with the baculovirus Autographa californica multicapside nucleopolyhedrovirus (AcMNPV) polyhedrin (PH) promoter. The pFastBac™1 constructs were then transformed in MAX Efficiency® DH10Bac™-competent cells (ThermoFisher Scientific, Waltham, MA), generating recombinant bacmids for transfection into Sf9 cells using Cellfectin® II Reagent (ThermoFisher Scientific, Waltham, MA). AcMNPVs expressing GP1,2s were verified for correct orientation 72 h after transfection of Sf9 cells in 6-well plates by western blot of cell supernatants. Supernatants containing AcMNPVs was then used for plaque purification with 10-fold dilutions. Individual plaques were purified by adding an agarose plug to a T150 Sf9 flask and incubating for 4 days. Supernatants from these flasks were titered using plaque assays of 95% confluent Sf9 cells and a 4% agarose overlay.
Pfastbac1
Manufactured by Thermo Fisher Scientific
Sourced in United States, Canada, Japan, Germany
PFastBac1 is a plasmid vector used in the Baculovirus Expression Vector System (BEVS) for the production of recombinant proteins in insect cells. The plasmid contains the necessary genetic elements for efficient cloning and expression of target genes in the BEVS system.
Automatically generated - may contain errors
Lab products found in correlation
Bac to bac baculovirus expression system, by Thermo Fisher Scientific (15 mentions)
Bac to bac system, by Thermo Fisher Scientific (10 mentions)
Sf9 cells, by Thermo Fisher Scientific (4 mentions)
Pcdna3, by Thermo Fisher Scientific (4 mentions)
T4 ligase buffer, by New England Biolabs (3 mentions)
Hifi dna assembly kit, by New England Biolabs (3 mentions)
T4 ligase, by New England Biolabs (3 mentions)
T4 polynucleotide kinase, by New England Biolabs (3 mentions)
Nucleospin pcr clean up kit, by Macherey-Nagel (3 mentions)
Glutathione sepharose, by GE Healthcare (3 mentions)
Pfastbac, by Thermo Fisher Scientific (3 mentions)
Pfastbac dual, by Thermo Fisher Scientific (3 mentions)
Ni nta, by Qiagen (3 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (3 mentions)
Bac to bac, by Thermo Fisher Scientific (3 mentions)
M2 agarose, by Merck Group (3 mentions)
Q sepharose beads, by GE Healthcare (3 mentions)
Flag m2 agarose beads, by Merck Group (3 mentions)
E coli dh5α, by Thermo Fisher Scientific (2 mentions)
Dpni, by New England Biolabs (2 mentions)
118 protocols using pfastbac1
1
Cloning and Expression of Modified GP Genes
2
Recombinant Baculovirus Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 1.2 kb DNA sequence was excised from pUC-OKer-His-Flag and sub-cloned into the donor vector pFastBac™-1 (Life Technologies) by BamHI/HindIII restriction sites to create pFastBac1-OKer-His-Flag in which expression of recombinant protein is driven by polyhedrin promoter. Recombinant bacmid was generated by transforming pFastBac1-OKer-His-Flag into E. coli DH10Bac™ cells (Life Technologies). Badmic DNA was extracted using phenol/chloroform method and used for recombinant baculovirus production.
Transfer vector pFastBac1-OKer-His-Flag and bacmid DNA were confirmed by PCR and sequencing using the primer sets (pFastbac-F:TATTCCGGATTATTCATACC , pFastBac-R: ACAAATGTGGTATGGCTGA ) and (MF13-F: GTTTCCCAGTCACGAC , MF13-R: CAGGAAACAGCTATGAC ), respectively.
Transfer vector pFastBac1-OKer-His-Flag and bacmid DNA were confirmed by PCR and sequencing using the primer sets (pFastbac-F:
3
Generation of anti-EpCAM mRNA CAR Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate anti-EpCAM mRNA CAR vectors, the above anti-EpCAM CAR sequence was subcloned into a pFastbac1 (Life Technologies) with EcoRI and SalI. For in vitro transcription of mRNA, the pFastbac1 vector was modified by adding a T7 promoter, a 5′UTR with Kozak sequence, a GM-CSF signal peptide (SP) encoding sequence and an alpha-globin 3′UTR sequence [39 (link)]. PCR was performed using the pFastbac1 vector as the DNA template, a forward primer CMV-F (5′-atccgctcgagtagttattaatagtaatcaattacggggtc-3′), and reverse primer T150-R. The control vector anti-CD19 CAR was produced by replacing the anti-EpCAM scFv with an anti-CD19 scFv sequence. Capped mRNA was generated through in vitro transcription of the PCR DNA templates using the mMESSAGE mMACHINE T7 ULTRA transcription kit (Invitrogen, Carlsbad, CA) or the mScript™ RNA system (Epicentre, Madison, WI). For mRNA electroporation, 0.2 ml of the expanded T cells was mixed with 20 μg mRNA and electroporated in a 2-mm cuvette (Bio-Rad, Hercules, CA) using a NEPA21 electroporator (Nepagene, Chiba, Japan) with the following parameters: voltage 240 V, pulse length 4 ms, pulse once. The electroporated T cells were rested for 3 hours and frozen to −80°C until injection.
4
Heterotrimeric Gi Protein-Bound GPR20 Complex Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The codon-optimized nucleotide sequence of human WT GPR20 (UniProt ID Q99678) was synthesized by GenScript. The human GPR20 gene was subcloned into an expression vector pFastBac1 (Invitrogen) with the addition of a haemagglutinin signal peptide, Flag tag, and a thermostabilized Escherichia coli apocytochrome b562RIL (BRIL)24 (link) at the N-terminus of the receptor gene as well as an HRV 3 C protease recognition site followed by a 10x His tag at the C-terminus. The human dominant-negative Gαi1 (DNGαi subunit was generated by introducing three mutations: S47N, G203A, A326S) and the human WT Gβ1γ2 subunits (codon-optimized and synthesized by GenScript) were cloned into a pFastBac1 and pFastBacDual (Invitrogen) vector, respectively. The Gi protein-bound GPR20 complexes were obtained by co-expressing the receptor, DNGαi and Gβ1γ2 in Trichuplusia ni Hi5 insect cells (Invitrogen, B85502) using the Bac-to-Bac Baculovirus Expression System (Invitrogen). Trichuplusia ni Hi5 cells were infected at a cell density of 2–2.5 × 106 cells per mL with three separate virus (MOI = 5) preparations for GPR20, DNGαi and Gβ1γ2 at a ratio of 1:2:2. The infected cells were cultured at 27 °C for 48 h before collection by centrifugation, and the cell pellets were stored at −80 °C for future use.
5
Baculoviral Vector for HERV-GmCSF Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A recombinant baculoviral vector expressing HERV env (pFastBac1-HERV) was previously constructed by inserting a synthetic, codon-optimized envelope gene of HERV type W (GenBank accession number NM014590; GenScript, Piscataway, NJ, USA) into pFastBac1 (Invitrogen) [21 (link)].
The M. musculus GmCSF (GmCSF) gene (GenBank accession number X03019.1) in pcDNA3.1 vector (pcDNA3.1-GmCSF), kindly provided by NBM (Iksan, Korea), was subcloned into HERV-expressing pFastBac1 under the control of the hEF1α (human elongation factor-α) promoter (pFBHERV-GmCSF).
Recombinant baculoviruses were produced using the Bac-to-Bac baculovirus expression system (Invitrogen) according to a manufacturer’s instructions. The recombinant baculovirus, AcHERV-GmCSF was further amplified by propagation in Sf9 cells. The supernatant from the cells were loaded on top of 30% sucrose, and purified by ultracentrifugation at 40,000 rpm at 4°C for 1 hour in a SW50.1 rotor (Beckman Coulter Inc., Brea, CA, USA). The virus pellet was suspended in phosphate-buffered saline (PBS) and used for immunization.
The M. musculus GmCSF (GmCSF) gene (GenBank accession number X03019.1) in pcDNA3.1 vector (pcDNA3.1-GmCSF), kindly provided by NBM (Iksan, Korea), was subcloned into HERV-expressing pFastBac1 under the control of the hEF1α (human elongation factor-α) promoter (pFBHERV-GmCSF).
Recombinant baculoviruses were produced using the Bac-to-Bac baculovirus expression system (Invitrogen) according to a manufacturer’s instructions. The recombinant baculovirus, AcHERV-GmCSF was further amplified by propagation in Sf9 cells. The supernatant from the cells were loaded on top of 30% sucrose, and purified by ultracentrifugation at 40,000 rpm at 4°C for 1 hour in a SW50.1 rotor (Beckman Coulter Inc., Brea, CA, USA). The virus pellet was suspended in phosphate-buffered saline (PBS) and used for immunization.
6
Recombinant HCAR2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression construct of human HCAR2, followed with a haemagglutinin (HA) signal sequence, Flag tag at the N-terminus, was inserted into the pFastBac1 (Invitrogen) baculovirus expression vector. The human DNGαi1 (S47N, G203A, E245A, A326S) and human Gβ1, bovine Gγ2 was constructed into pFastBac1(Invitrogen) and pFastBac-dual (Invitrogen) vector respectively.
7
Purification of Stable Mammalian Fpn Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain a purified mammalian Fpn protein conducive for biophysical studies, we generated a protein construct with an increased thermal stability (Deshpande et al., 2018). In brief, the construct (Fpn-C2) was generated from full-length mouse Fpn (UniProt: Q9JHI9 [https://www.uniprot.org/uniprot/Q9JHI9 ]) by deleting two-loop regions (residues 251–290 and 401–449), followed by an overlapping PCR incorporating the E219A mutation to generate Fpn-C2-E219A. The genes were subsequently cloned with a C-terminal GFP fusion into a baculovirus transfer vector (pFastBac1; Thermo Fisher Scientific) and the proteins were expressed using the Bac-to-Bac Baculovirus and Sf9 cells (Thermo Fisher Scientific) expression method according to the manufacturer’s protocol (Thermo Fisher Scientific). For large scale expression of the protein, 6L Sf9 cells (2 × 106 cells/ml) were infected with virus at an optimal multiplicity of infection (MOI) of 2.5 in Insect-XPRESS™ Protein-free Insect Cell Medium with l -glutamine (Lonza) and incubated at 27 °C with shaking at 130 rpm. The cells were spun down 48 h post-infection at 1500 × g for 10 min and the pellet stored at −20 °C until further use.
8
Cloning and Expression of MjgC1qR in Kuruma Shrimp
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from adult Kuruma shrimp (10.1 cm of total length and 8.1 g of body weight) using ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturer’s protocol. First-strand cDNA was synthesized with 5 μg of total RNA using ReverTra Ace (Toyobo, Shiga, Japan) and was kept at − 30 °C until use. The obtained cDNA was used as a template for amplifying the MjgC1qR gene without a stop codon using MjgC1qR-FW-BamHI and MjgC1qR-RV-XhoI-NoStop. The final PCR products were cloned into pET-41a( +) (MERCK Japan) to fuse the gene with a polyhistidine-tagged sequence at the C-terminus (designated pET41-MjgC1qR-His), and positive clones were selected and sequenced. MjgC1qR-His was amplified from pET41-MjgC1qR-His using MjgC1qR-FW-BamHI and pET41-RV and cloned into pFastbac-1 (Thermo Fisher Scientific K. K, Tokyo, Japan), and the product was named pFB-MjgC1qR-His. The sequence was confirmed again via DNA sequencing. All the primers (including their sequences) are listed in Table 2 .
9
Recombinant SARS-CoV-2 Spike Protein RBD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The amino acid sequence of the SARS-CoV-2 spike protein was obtained from the SARS-CoV-2 reference genome Wuhan-Hu-1 (Genbank accession number: NC_045512.2). For the design of RBD construct, the Pro330-Ser530 region was selected. The sequence was optimized for expression in insect cells, the gp67 secretion signal peptide was added at the N-terminal and a 6xHis-tag in the C-terminal region. The resulting sequence was chemically synthesized by GenScript Laboratories and cloned at the EcoRI/HindIII sites of pFastBac1 (Thermo Fisher Scientific, USA) under the control of the polyhedrin promoter and upstream of the SV40 polyadenylation sequence. Transformation of competent DH10BAC cells and transfection of Sf9 cells were performed with the Bac-to-Bac technology following the manufacturer’s instructions (Thermo Fisher Scientific, USA).
10
Cloning and Mutagenesis of PEDV Spike Ectodomain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein sequence of Porcine epidemic diarrhea virus (PEDV) USA/Colorado/2013 spike ectodomain 1-1322 with a C-terminal foldon, TEV site, His-tag and Strep-tag was codon optimized for mammalian expression (Genscript) and inserted into pFastBac1 (Thermo Fisher, Cat. #10360014) using EcoRI and XbaI restriction sites (Genscript). The insert was further cloned into pcDNA3.4 using the HiFi DNA Assembly Kit (New England Biolabs) and PCR products (Phusion polymerase, Thermo Fisher, Cat. #F530L) for spike (PEDV fwd and rvs) and for pcDNA3.4 (pcDNA34 fwd and rvs).
The Asn264Asp in spike-pcDNA3.4 substitution and 34-230 deletion spike (based on genbank sequence AMK69964) in spike-pFastBac1 mutants were made by Phusion PCR of the parent templates using N264D fwd and rvs or PEDVS0033 rvs and PEDVS0231 fwd primers. The resulting PCR products were purified with NucleoSpin PCR cleanup kit (Machery Nagel, Cat. #740609.50) to which was added 10X PNK buffer, 1 μL T4 polynucleotide kinase and 1 μL DpnI (New England Biolabs, Cats. #M0201S and R0176S) and incubated at 37°C for 1 hour. 3μL of this reaction, 1μL of 10X T4 ligase buffer, 1μL of T4 ligase (New England Biolabs, Cat. #M0202S) and 5μL of water were incubated at room temperature for 1 hour. The ligated DNA was then transformed into DH5α E. coli (Thermo Fisher, Cat. #18258012) and selected on LB broth agar with 100μg/mL ampicillin.
The Asn264Asp in spike-pcDNA3.4 substitution and 34-230 deletion spike (based on genbank sequence AMK69964) in spike-pFastBac1 mutants were made by Phusion PCR of the parent templates using N264D fwd and rvs or PEDVS0033 rvs and PEDVS0231 fwd primers. The resulting PCR products were purified with NucleoSpin PCR cleanup kit (Machery Nagel, Cat. #740609.50) to which was added 10X PNK buffer, 1 μL T4 polynucleotide kinase and 1 μL DpnI (New England Biolabs, Cats. #M0201S and R0176S) and incubated at 37°C for 1 hour. 3μL of this reaction, 1μL of 10X T4 ligase buffer, 1μL of T4 ligase (New England Biolabs, Cat. #M0202S) and 5μL of water were incubated at room temperature for 1 hour. The ligated DNA was then transformed into DH5α E. coli (Thermo Fisher, Cat. #18258012) and selected on LB broth agar with 100μg/mL ampicillin.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!