Genomic DNA was extracted from B16F10 cells after transfection for 72 h using QuickExtract DNA Extraction solution (Epicentre). The polymerase chain reaction (PCR) was performed with 100 ng genomic DNA, 1 μL high fidelity phusion polymerase (New England Biolabs) and the primers (details in Supporting Information Table S1 ) at an annealing temperature of 60 °C. 200 ng purified PCR products were hybridized according to the following condition, heating to 95 °C and ramping down to 25 °C with specific ramp rate. T7EI enzyme (NEB) was used to digest the reannealed PCR products. The cleavage products were loaded into 2% agarose gel and visualized with a Gel Doc gel imaging system. To further analyze the indel mutation sequence, TA cloning was performed with the PCR products and colonies were picked up randomly for sequencing.
T7ei enzyme
Manufactured by New England Biolabs
Sourced in United States
T7EI enzyme is a structure-specific endonuclease that recognizes and cleaves DNA heteroduplex structures. It is useful for detecting single nucleotide polymorphisms and other genetic variations.
Automatically generated - may contain errors
5 protocols using t7ei enzyme
1
Genomic DNA Extraction and Indel Mutation Analysis
2
Identification of Genomic Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR amplicons of target genomic regions were mixed with control non-mutated product, denatured and annealed at a temperature gradient from 95 to 25°C at a speed of 0.1°C/s. Hybridization products were digested using the T7EI enzyme (New England Biolabs) for 1 h at 37°C. Reaction products were separated by electrophoresis in an ethidium bromide-stained 2% agarose gel. The deletion boundaries and insertion sizes were determined by Sanger sequencing of the PCR products (Genome Center). The PCR primers used are listed in Table S1 .
3
Quantifying CRISPR/Cas9 Editing Efficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
When the target gene does not include an appropriate RE site, the T7EI assay is a better option for assessing CRISPR/Cas9 efficiency. The T7EI nuclease can digest CRISPR/Cas9-induced mismatched dsDNA, leaving behind WT and mutant homoduplexes. Amplicons of sgRNACr3-CM and sgRNACrP1-CM were digested with T7EI enzyme (NEB, United States). An EtBr-stained 3.0% agarose gel was used for separating bands.
The indel frequency was calculated from the following formula:
where a is intensity of undigested PCR product, while b and c are intensities of the two digested products. Mean indel efficiency was calculated from the three independent replicates.
The indel frequency was calculated from the following formula:
where a is intensity of undigested PCR product, while b and c are intensities of the two digested products. Mean indel efficiency was calculated from the three independent replicates.
4
Genotyping of CRISPR/Cas9-Edited Tomato Transgenic Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from tomato T0 transgenic plants was extracted using CTAB methods, and the genomic flanks containing the target sites were amplified using specific primers (Supplementary Table S10 ). Then, 300 ng of purified PCR products were denatured-annealed and digested with T7EI enzyme (NEB, USA) at 95 °C for 5 minutes in a water bath and were then allowed to cool to room temperature. The annealed PCR products were digested with 0.5 μl T7EI for 1 h at 37 °C and then were subjected to 2% agarose gel electrophoresis. For genotyping of T0 plant, the PCR products amplified with specific primers (Supplementary Table S10 ) were directly cloned into the pGEM-T easy Vector (Promega, USA), and approximately 10 clones were sequenced for each plant with the M13 primer. For the genotyping of T1 and T2 plants obtained from the T0 lines by strict self-pollination, the target fragments were directly sequenced.
5
Quantifying Gene Modification via T7EI Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA of cells was extracted and purified using Cell and Tissue DNA Extraction Kit (BIOMED). The extracted DNA was PCR-amplified using the following primer pair: Sa4-T7EI F: TTGACTACTAGATCCCTGGATGCTG; Sa4-T7EI R: ACTCTTGGACTCCCAGCAATGTCAA. The PCR product was denatured at 95°C for 10 min, gradually cooled to room temperature, and then digested with T7EI enzyme (NEB) according to manufacturer instructions. The digested product was separated and visualized in 2% agarose gels and the mutation rate was calculated based on the grayscale intensity of bands as follows: % gene modification = 100 × (1 – (1 – fraction cleaved)1/2).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!