Relative expression of cytokines was quantified by QPCR 4 h after SLURP1 or control protein pretreated HUVEC cells were exposed to 10 ng/ml TNF-α. Total RNA was isolated using EZ-10 spin column total RNA mini-prep kit from Bio Basic Inc. (Amherst, NY), 300 ng of which was used for cDNA synthesis with Mouse Moloney Leukemia Virus reverse transcriptase (Promega, Madison, WI). SYBR Green gene expression assays were performed in triplicate in ABI StepOne Plus thermocycler with validated primers from realtimeprimers.com (Elkins Park, PA) using 18S rRNA, RPL13A or Actin-B as endogenous control. QPCR results were analyzed using StepOne software (Applied Biosystems). Results shown are the average of three independent experiments.
Ez 10 spin column total rna miniprep kit
Manufactured by Bio Basic
Sourced in United States, Canada
The EZ-10 Spin Column Total RNA Miniprep Kit is a laboratory equipment designed for the rapid and efficient isolation of total RNA from a variety of sample types. The kit utilizes a spin column-based method to capture and purify RNA, providing a simple and streamlined extraction process.
Automatically generated - may contain errors
Lab products found in correlation
Mouse maloney leukemia virus reverse transcriptase, by Promega (4 mentions)
Steponeplus thermocycler, by Thermo Fisher Scientific (2 mentions)
Mouse moloney leukemia virus reverse transcriptase, by Promega (1 mentions)
Stepone software, by Thermo Fisher Scientific (1 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Nanodrop technology, by Thermo Fisher Scientific (1 mentions)
Protoscript 2 reverse transcription, by New England Biolabs (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Abi stepone plus thermocycler, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Cfx connect rt pcr detection system, by Bio-Rad (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Sybr green master mix, by Selleck Chemicals (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
All in one 5x rt mastermix, by Applied Biological Materials (1 mentions)
Verso cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
Turbo dnase, by Thermo Fisher Scientific (1 mentions)
10 protocols using ez 10 spin column total rna miniprep kit
1
Quantifying Cytokine Expression in TNF-α Stimulated HUVECs
2
Mouse Cornea and OSSN RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from dissected mouse corneas or OSSN tissues using EZ-10 spin column total RNA mini-prep kit (Bio Basic, Inc., Amherst, NY, USA). Isolated RNA (500 ng) was used for cDNA synthesis with mouse Maloney leukemia virus reverse transcriptase (Promega, Madison, WI, USA). SYBR Green quantitative RT-PCR (RT-qPCR) gene expression assays were performed in triplicate in an ABI StepOne Plus thermocycler using appropriate endogenous controls (Applied Biosystems, Foster City, CA, USA). The sequence of oligonucleotide primers used for RT-qPCR (synthesized by Integrated DNA Technologies, Inc., Coralville, IA) is presented in Supplementary Table S2 .
3
Total RNA Extraction from Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using EZ-10 Spin Column Total RNA Miniprep Kit (Bio Basic Inc., Canada) according to the manufacturer’s instructions. The purity and quantity of the extract were determined by Nanodrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA).
4
Total RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were collected by trypsinization and centrifugation, then washed once with 10% BSA in PBS and once with PBS. RNA was prepared using the EZ-10 Spin Column Total RNA Miniprep Kit [BS1361(SK8655); BioBasic] according to the manufacturer’s instructions. RNA was quantified using NanoDrop technology (Thermo Fisher Scientific), and, for each sample, 1 µg RNA was converted to cDNA using ProtoScript II reverse transcription (M0368; New England Biolabs) in a 20-μl reaction. 0.5 μl of reverse transcription was used per 10-μl qPCR (Luna Universal qPCR Master Mix).
Total RNA from mouse muscle was extracted using TRIzol and then transcribed to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). Expression of selected genes was analyzed using the LightCycler 480 system (Roche) and SYBR Green chemistry. All qPCR results were presented relative to the mean of 36b4, B2m, and/or Gapdh (comparative cycle threshold method). Primer sequences are specified inTable 1 .
Total RNA from mouse muscle was extracted using TRIzol and then transcribed to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). Expression of selected genes was analyzed using the LightCycler 480 system (Roche) and SYBR Green chemistry. All qPCR results were presented relative to the mean of 36b4, B2m, and/or Gapdh (comparative cycle threshold method). Primer sequences are specified in
5
Quantitative RT-PCR Analysis of Mouse Corneal and HCLE Cell Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from mouse corneas or HCLE cells was isolated using EZ-10 spin column total RNA mini-prep kit (Bio Basic, Inc., Amherst, NY, USA) and used for cDNA synthesis with mouse Maloney leukemia virus reverse transcriptase (Promega, Madison, WI, USA). qPCR was performed using SYBR Green gene expression assays in triplicate using an ABI StepOne Plus thermocycler with appropriate endogenous controls (Applied Biosystems, Foster City, CA, USA). The sequence of primers used for qPCR is shown in Supplemental Table S1 .
6
Isolation and Quantification of Corneal Epithelial RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Corneal epithelium was isolated by incubating mouse eyeball with Dispase for 2 hours at 37°C. Total RNA was isolated from mouse CE, HCLE cells, or human pterygium tissues using the EZ-10 Spin Column Total RNA Miniprep Kit (Bio Basic, Inc., Amherst, NY, USA). Isolated RNA was converted into cDNA using mouse Maloney leukemia virus reverse transcriptase (Promega, Madison, WI, USA). SYBR Green RT-qPCR gene expression assays were performed in duplicate a StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using appropriate endogenous controls. The sequence of oligonucleotide primers used for quantitative reverse transcription PCR (RT-qPCR) is presented in Supplementary Table S2 .
7
RNA Isolation and qPCR Analysis of TGF-β1 Effects
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolated from dissected mouse corneas or HCLE cells treated with and without TGF-β1 using the EZ-10 spin column total RNA mini-prep kit (Bio Basic, Inc., Amherst, NY, USA) was used for cDNA synthesis with mouse Maloney leukemia virus reverse transcriptase (Promega, Madison, WI, USA). SYBR Green gene expression assays were performed in triplicate in an ABI StepOne Plus thermocycler using appropriate endogenous controls (Applied Biosystems, Foster City, CA, USA). The sequence of different primers used for qPCR is shown in Supplementary Table S2 .
8
Quantifying Hypothalamic GnRH Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA isolation from collected hypothalamus tissue was performed using the EZ-10 Spin Column Total RNA Miniprep Kit (BioBasic, Canada). cDNA synthesis from RNA samples was performed using the iScript cDNA Synthesis Kit (BioRad, USA). RT-PCR analysis was performed on the CFX Connect RT-PCR Detection System (Bio-Rad Laboratories) using SYBR Green Master Mix (BioRad Biosystems) in the presence of speci c primers. The primers used in the study are as follows: Rattus norvegicus beta-actin (Actb): 5' CTAAGGCCAACCGTGAAAAG 3' (forward) and 5' GCCTGGATGGCTACGTACA 3' (reverse); Rattus norvegicus GnRH1: 5' TCTGCGAGGAGCTCTGG 3' (forward) and 5' GGGCCAGTGCATTACATCTT 3'(reverse). Reaction volumes were set as 10 µl. The 5 µl master mix containing 0.5 µl real time ready mix, 2 µl PCR grade water, and 2.5 µl cDNA was prepared. Samples were run as triplicate. The cycling protocol was set as an initial 10 min denaturation step at 95°C, followed by 55 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 1 s. To determine the change in the GnRH gene expression among the groups, β-actin gene was selected as housekeeping gene; and relative messenger RNA (mRNA) expression levels were calculated according to housekeeping genes using the 2 - ΔΔCt method [19] (link).
9
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from cells and tissues using the EZ-10 Spin Column Total RNA Miniprep Kit (Bio Basic, BS1361) according to the manufacturer protocol. After RNA extraction, cDNA was synthesized using the All-in-one 5x RT MasterMix (ABM, G592). qPCR reactions were performed with the 2X SYBR Green Master mix (Bimake, B21203) and run on the CFX Connect Real-Time PCR Detection System (Bio-Rad, 1855201). Gapdh was used for normalization. Student’s t-test was performed based on the ΔΔCT values. Unless otherwise specified, n=3 biological replicates per group were used for all qRT-PCR experiments. Primers were purchased from Eurofins Genomics. Primer sequences are listed in Supplementary Table 1
10
Quantitative RNA Analysis of Bacterial Growth
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from bacterial cultures during exponential growth (OD600 nm = 0.12–0.15) and stationary phase (OD600 nm = 2.0). 0.2OD600 nm units of bacteria were harvested, held on ice and 2/5 volume of stop solution (95% ethanol/5% phenol) was added. Total RNA was extracted using an EZ-10 Spin Column Total RNA Miniprep kit (Bio-Basic, Canada) and RNA concentration was quantified using a Nanodrop ND-1000. 2 μg of RNA from each sample was DNase treated using Turbo™ DNase (Invitrogen™) in a 50 μl reaction and 5 μl of DNase treated RNA was then reverse transcribed using a Verso cDNA synthesis kit (Thermo Scientific™) to generate cDNA pools. The relative abundance of target mRNA molecules was determined by quantitative reverse transcription PCR (qPCR) using gene specific primer pairs (Supplementary Table S6 ) and iTaq™ Universal SYBR® Green Supermix (Bio-Rad). Quantification of mRNA was achieved using an internal calibration curve generated from serially diluted genomic DNA of known quantity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!