Pcdna3.1 nc

K562 and KCL22 cells were seeded into 6-well plates (2 × 10⁵ cells/well). After 24 h-incubation, cells were transfected with inhibitor NC, miR-223 inhibitor, pcDNA3.1-NC, pcDNA3.1-FLT3, si-NC, or si-FLT3 (Genechem Co., Ltd., Shanghai, China) (siRNA 50 nM, miRNA-inhibitor 30 nM) using Lipofectamine 2000 (11668–019, Invitrogen, Carlsbad, CA, USA).
The cells were allocated into blank group, DMSO group, 2-ME group, AA group, 2-ME + AA group, 2-ME + AA + inhibitor NC group, 2-ME + AA + miR-223 inhibitor group, 2-ME + AA + pcDNA3.1-NC group, 2-ME + AA + pcDNA3.1-FLT3 group, 2-ME+AA+miR-223 inhibitor+si-NC group, and 2-ME+AA+miR-223 inhibitor+si-FLT3 group. The concentrations of 2-ME and AA were the corresponding IC50 values.

miR-26b mimic and inhibitor were employed to overexpress or knockdown miR-26b (both from Guangzhou RiboBio Co., Ltd., Guangzhou, China). pcDNA3.1-JAG1 and its negative control (pcDNA3.1-NC) were designed and synthesized from Sangon Biotech Co., Ltd. (Shanghai, China). Human cervical cancer cells HeLa and JAR were seeded in 6-well plates and when the cells were 80% transfection was performed. pcDNA3.1-JAG1 and pcDNA3.1-NC were transfected with Lipofectamine 3000, whereas miR-26b mimic or inhibitor used Lipofectamine 2000 (both from Invitrogen; Thermo Fisher Scientific, Inc.).

The pcDNA3.1/circ_0017639 and sh-circ_0017639 were developed by GenePharma (Shanghai). H1755 and H2170 cells (2 × 10⁵ cells) were then incorporated with 2 μg pcDNA3.1/circ_0017639 (circ_0017639) or pcDNA3.1/NC (vector), A549 and H1299 cells (2 × 10⁵ cells) were incorporated with 100 nM sh-circ_0017639 (CGGTGACTAAGCAATCAAAGA) or sh-negative control (sh-NC), Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) per operational guidelines. Following 48 h of incubation, the cells underwent additional examinations.

The recombinant plasmids, pcDNA3.1-MAGT1, pcDNA3.1-TCF12 and the negative control (NC), pcDNA3.1-NC were purchased from Shanghai GeneChem Co., Ltd. MAGT1-specific short hairpin (sh)RNAs (sh-MAGT1-1 and sh-MAGT1-2), non-targeting shRNA, TCF12-specific small interfering (si)RNAs (si-TCF12-1 and si-TCF12-2) and non-targeting siRNA were synthesized, and purified by Guangzhou RiboBio Co., Ltd. Subsequently, 2 µg/ml plasmids, shRNAs and siRNAs were transfected or co-transfected (si-TCF12-2 + pcDNA3.1-MAGT1 or pcDNA3.1-NC) into the BxPC-3 cell line using Lipofectamine^® 3000 Reagent (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C for 6 h according to manufacturer's recommendations. Untransfected cells served as an additional control. At 48 h after transfection, cells were selected for subsequent experiments. The sequences are as follows: sh-MAGT1-1 sense, 5′-GGTCAAATGTGGAACCATA-3′ and antisense 5′-TATGGTTCCACATTTGACC-3′; sh-MAGT1-2 sense, 5′-GGAGATGGTGTTATCTGAA-3′ and antisense, 5′-TTCAGATAACACCATCTCC-3′; sh-NC sense, 5′-GATCCCCCTTCTCCGAACG-3′ and antisense, 5′-AGCTAAAAATTCTCCGAAC-3′; si-TCF12-1 sense, 5′-CAGCAGAGAUACUGGAUUA-3′ and antisense, 5′-UAAUCCAGUAUCUCUGCUG-3′; si-TCF12-2 sense, 5′-GGAACAAGUGGUCAACCAA-3′ and antisense, 5′-UUGGUUGACCACUUGUUCC-3′; and si-NC sense, 5′-GGCUCUAGAAAAGCCUAUGC-3′ and antisense, 5′-CCGAGAUCUUUUCGGAUACG-3′.

HER-2-positive breast cancer cells BT-474 and SK-BR-3 and the normal breast epithelial cell line MCF-10A were obtained from the American Type Culture Collection. Both cell lines were grown in Roswell Park Memorial Institute medium (Thermo Fisher Scientific, Inc.), which was supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin. The cells were maintained at 37°C in a humidified atmosphere at 5% CO₂.
miR-135b-5p agomir (5′-UAU GGC UUU UUA UUC CUG UGU GA-3′) and its negative control (NC; 5′-UUU GUA CUA CAC AAA AGU ACU G-3′) were synthesized and purchased from Guangzhou RiboBio Co., Ltd. The cells were transfected with 50 nM miR-135b-5p agomir and its NC (50 nM) using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 24 h according to the manufacturer's protocol. Cells in the blank group were not given any treatment.
pcDNA3.1-cyclin D2 was purchased from Shanghai GenePharma Co., Ltd. BT-474 cells were transiently transfected with 2 µg/ml pcDNA3.1-NC or 2 µg/ml pcDNA3.1-cyclin D2 using Lipofectamine™ 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 48 h according to the manufacturer's instructions.