Thermoscientific phusion high fidelity pcr master mix

Bacterial sequencing libraries were constructed according to the procedure described by Caporaso et al. (2011). Briefly, the V4 region of bacterial 16S rRNA genes was amplified by the primers 515F/806R using the ThermoScientific^®Phusion High‐Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, USA). All amplifications were conducted in a 30 μl mixture including 15 μl of 2 × Master mix, 0.5 μM final concentration of forward and reverse primers, 10 ng of template DNA and nuclease‐free water. The PCR products were purified using PCR Purification Kit (QIAGEN, Hilden, Germany) and quantified using Qubit^® 2.0 Fluorometer (Invitrogen, Carlsbad, CA, USA). The purified amplicons were employed for library construction with the NEB Next^® Ultra™ DNA Library Prep Kit (New England Biolabs). The final library was quality‐assessed with Agilent 2100 Bioanalyzer Instruments (Agilent Technologies, Palo Alto, CA, USA) and quantified using KAPA Library Quantification Kits (Kapa Biosystems, Wilmington, MA, USA). All constructed libraries were sequenced by Illumina HiSeq 2000 at Novogene Bioinformatics Institute (Beijing, China).

The total DNA was extracted from each Douchi sample by a SDS-based DNA extraction method previously described^{29 (link)}. DNA quality was monitored by agarose gel electrophoresis, and stored at −20 °C for subsequent analysis. Primers of 515 F (GTGCCAGCMGCCGCGGTAA) and 806 R (GGACTACHVGGGTWTCTAAT) were designed according to the V4 region of bacterial 16S rRNA gene, and ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (GCTGCGTTCTTCATCGATGC) were designed based on the ITS1 region of the fungal internal transcribed spacer (ITS).
The Miseq sequencing for bacteria and fungi followed the protocols described by Caporaso et al. and Kozich et al.^{30 (link),31 (link)}, respectively. The bacterial 16S rDNA and fungal ITS genes fragments were amplified using the total DNA, primers, and Thermo Scientific® Phusion High-Fidelity PCR Master Mix (New England Biolabs, UK), purified by the QIAquick PCR Purification Kit (QIAGEN, Germany). Then, purified amplicons were employed for DNA library construction using the TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina). At last, DNA libraries were evaluated using Qubit@ 2.0 Fluorometer (Thermo Scientific) and real-time PCR, then sequenced on the MiSeq platform at Beijing Novogene Bioinformatics Technology Co., Ltd. All experiments were conducted in three replicates.