The largest database of trusted experimental protocols

Chlorpromazine hydrochloride cpz

Manufactured by Merck Group
Sourced in United States, Spain, Germany

Chlorpromazine hydrochloride (CPZ) is a chemical compound used as a laboratory reagent. It is a white or off-white crystalline powder. The core function of CPZ is to serve as a reference standard or analytical tool in various research and testing applications.

Automatically generated - may contain errors

7 protocols using chlorpromazine hydrochloride cpz

1

Inflammatory Responses of Macrophages and Microglia

Check if the same lab product or an alternative is used in the 5 most similar protocols
Raw264.7 macrophages were purchased from the Cell Bank of Chinese Academy of Sciences (Shanghai). BV‐2 microglia were obtained from Fuheng Biology Science and Technology Co., Ltd. The Raw264.7 cells and BV‐2 cells were cultured with the Dulbecco's modified Eagle medium (DMEM, from Gibco) in a humidified incubator at 37 °C and with 5% CO2. The media were supplemented with 10% fetal bovine serum (FBS, from Gibco), 100‐U/ml streptomycin (Invitrogen), and 100‐U/ml penicillin (Invitrogen). CpG ODN (5′‐TCCATGACGTTCCTGACGTT‐3′) was from BioSune Biotechnology Co. Ltd. Poly (allylamine hydrochloride) (PAH) (15 kDa), genipin, chlorpromazine hydrochloride (CPZ), methyl‐β‐cyclodextrin (MβCD), and 5‐(N‐methyl‐N‐isobutyl) amiloride (MIBA) were from Sigma‐Aldrich. LysoTracker™ Deep Red was from Invitrogen. 4’,6‐Diamidino‐2‐phenylindole dihydrochloride (DAPI) and Cell Counting Kit‐8 (CCK‐8) were from Beyotime. The TNF‐α and IL‐6 enzyme‐linked immunosorbent assay (ELISA) kits were from Jianglai Industrial Co., Ltd.
+ Open protocol
+ Expand
2

Cellular Uptake Kinetics of Biomolecule-Loaded Lipid Particles

Check if the same lab product or an alternative is used in the 5 most similar protocols
DBTRG-05MG or RG2 cells were seeded in 24-well tissue-culture plates at a density of 2.5 × 105 cells/well for 18 h. The cells were pre-treated with Amiloride hydrochloride hydrate (AHH, 13.3 mg/mL, Sigma-Aldrich), Filipin III (FIII, 1 μg/mL, Sigma-Aldrich) or Chlorpromazine hydrochloride (CPZ, 10 μg/mL, Sigma-Aldrich) for 1 h and then the above inhibitors were removed. Subsequently, the cells were treated with BP/LPPC containing 50 μg/mL of BP at 37°C for 0, 15, 30, 45, 60 and 90 min. After incubation, the cells were harvested by 0.05% trypsin-EDTA (Gibco/Thermo Fisher) and broken by multiple frozen-thaws. BP in the LPPCs was extracted by phenol-chloroform and determined by a fluorescence spectrometer (Hitachi F-4500, Tokyo, Japan).
+ Open protocol
+ Expand
3

Bile Acid and Chlorpromazine Exposure Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chlorpromazine hydrochloride (CPZ; Sigma-Aldrich) solution (0, 10, 20, 30, 40, 50, 80, 160 or 320 μM) was dissolved in the exposure medium (CDM without NAC to reduce antioxidant levels) and prepared freshly before the experiment. The forty- and 80-fold (40×, 80× and 100×) concentrated BA cocktail consisted of five abundant BAs (obtained from Sigma-Aldrich) normally present in human plasma [22 (link)–24 (link)], shown in Table 1.

Bile acid concentrations in normal human plasma

Bile acidConcentration in plasma (μM)In vitro assay concentration (μM)
(40×)(80×)(100×)
Glycochenodeoxycholate1.3252.8105.6132.0
Deoxycholic acid0.4015.931.940.0
Chenodeoxycholic acid0.3915.731.439.0
Glycocholic acid0.3514.228.335.0
Glycodeoxycholic acid0.3112.424.731.0
+ Open protocol
+ Expand
4

Immunofluorescence Staining of Ebola Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hoechst 33342 dye (#62249) and HCS CellMask blue (#H32720) for immunostaining were purchased from ThermoFisher Scientific (Waltham, MA, USA) and used at 1:10,000 and 1:1000 in PBS, respectively. Mouse monoclonal anti-ZEBOV GP (4F3) and anti-ZEBOV VP40 (3G5) antibodies were obtained from IBT Bioservices (Gaithersburg, MD, USA). Mouse monoclonal anti-ZEBOV NP (10B5 C11 C9 C3), and VP35 (2A11 F12 D7) were obtained by Dr. D. Leung (Wash. U. St. Louis, MI, USA). Rabbit polyclonal anti-Ebola VP30 (GTX134035) was purchased from GeneTex (Irvine, CA, USA). Rabbit polyclonal anti-CAPG antibody (10194-1-AP) was from Proteintech (Rosemont, IL, USA). Mouse monoclonal anti-β-actin (MAB8929) antibody was from R&D systems. The following secondary antibodies were purchased from Thermo Scientific: goat anti-mouse Alexa Flour 488, anti-mouse Alexa Flour 546. 5-(N-ethyl-N- isopropyl) amiloride (EIPA) and chlorpromazine hydrochloride (CPZ) were from Sigma-Aldrich (St. Louis, MO, USA). EIPA was diluted to 10 mM with dimethylsulfoxide. CPZ was diluted to 50 mg/mL with water. All the reagents described here were kept at −40 °C until use.
+ Open protocol
+ Expand
5

Evaluation of Antioxidant and Cytoprotective Effects

Check if the same lab product or an alternative is used in the 5 most similar protocols
All reagents were of analytical grade. Trypan blue (0.4%) dye, hydrogen peroxide (H2O2) 30% w/w, 2,5-diphenyl-3-(4,5-dimethyl-2-thiazolyl) tetrazolium bromide (MTT), dimethylsulfoxide (DMSO), 2,7-dichlorodihydrofluorescein diacetate (DCF) and chlorpromazine hydrochloride (CPZ, CAS No. 69–09-0) were supplied from Sigma-Aldrich (Madrid, Spain). Dulbecco’s modified Eagle’s medium (DMEM) with and without phenol red, fetal bovine serum (FBS), phosphate buffered saline (PBS), l-glutamine solution (200 mM), trypsin-ethylenediaminetetraacetic acid (EDTA) solution (170,000 U/L trypsin and 0.2 g/L EDTA) and penicillin-streptomycin solution (10,000 U/mL penicillin and 10 mg/mL streptomycin) were acquired from Lonza (Verviers, Belgium). All analytical standards used for liquid chromatography analysis shikimic acid, gallic acid, 5-O-caffeoylquinic acid, 3-O-caffeoylquinic acid, (+)-catechin hydrate, (−)-epicatechin, rutin, hyperoside, naringin, quercitrin, 3,5-di-O-caffeoylquinic acid, rosmarinic acid, cinnamic acid, eugenol and trans-cinnamaldheyde were purchased from Sigma-Aldrich (Milan, Italy). The 75 cm2 culture flasks and 96-well plates were obtained from TPP (Trasadingen, Switzerland). HyClone fetal bovine serum (FBS) was purchased from Thermo Scientific (Northumberland, United Kingdom).
+ Open protocol
+ Expand
6

Transcytosis of ZIKV across Polarized Cell Barrier

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were seeded to 24-well PET cell culture inserts, 0.4-μm pore size for 7 days, in a two-chambered system. In this system, barrier cells form a polarized monolayer with tight junctions between cells, allowing access to both apical and basolateral domains. Cells were incubated for 30 min with various transcytosis inhibitors in different concentration, including 10 μM of nystatin (Sigma), 10 μM of chlorpromazine hydrochloride (CPZ, Sigma), 20 μM of dimethyl amiloride (DMA, Sigma), and 10 μM of colchicine (Sigma). Drugs were administered to the cells in both apical and basolateral chambers at identical concentrations. Thereafter, 100 μl of Atto647-ZIKV (2 × 106 copies ml–1 of virus) was added into the upper chamber. After 4 h incubation with cells, all of the basolateral supernatant was collected. Percent transcytosis was determined by measuring the fluorescence intensity of Atto647N through using a fluorescent plate reader.
+ Open protocol
+ Expand
7

Synthesis of VUAA1 Compound

Check if the same lab product or an alternative is used in the 5 most similar protocols
VUAA1 (N-(4-ethylphenyl)-2-((4-ethyl-5-(3-pyridinyl)-4H-1,2,4-triazol-3-yl)thio)acetamide) was synthesized by the working group “Mass Spectrometry/Proteomics” of the Max Planck Institute for Chemical Ecology (Jena, Germany). W7 hydrochloride was purchased from Tocris bioscience (Wiesbaden-Nordenstadt, Germany), Chlorpromazine hydrochloride (CPZ) and ethyl hexanoate (99% purity) from Sigma Aldrich (Steinheim, Germany).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!