Using the Plant RNA Kit (TaKaRa, Dalian, China) and following the manufacturer’s instructions, the total RNA was isolated from leaf samples. The qualified total RNA was digested with gDNA Eraser (TaKaRa, Dalian, China) to eliminate genomic DNA. The PrimeScriptTM RT reagent kit (TaKaRa, Dalian, China) was then used to create the first-strand complementary DNA (cDNA) from the treated total RNA. According to the manufacturer’s instructions, qRT-PCR was carried out with a qTOWER3G Real-Time PCR System (Analytik Jena AG, Jena, Germany) using TB Green® Premix Ex Taq™ II reagent (TaKaRa, Dalian, China). The experiment was replicated three times. The rice OsActin gene (LOC_Os03g50885) was used as the internal control. Based on the preceding techniques, the relative expression levels of the target genes were calculated [50 (link)]. The details of each gene-specific primer are presented in Table 1 and were taken from our previous study [38 (link)].
Plant rna kit
Manufactured by Takara Bio
Sourced in China, Japan
The Plant RNA Kit is a laboratory instrument designed to extract and purify high-quality total RNA from plant samples. The kit includes all necessary reagents and components to efficiently isolate RNA from a variety of plant tissues.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (4 mentions)
Agilent bioanalysis 2100 system, by Agilent Technologies (2 mentions)
Hiseq x ten platform, by Illumina (2 mentions)
Cbot cluster generation system, by Illumina (2 mentions)
Tb green premix ex taq 2, by Takara Bio (2 mentions)
Biorad iq5 real time pcr instrument, by Bio-Rad (2 mentions)
Sybr qpcr master mix, by Vazyme (2 mentions)
Gdna eraser, by Takara Bio (1 mentions)
Tb green premix ex taq 2 reagent, by Takara Bio (1 mentions)
Qtower3g real time pcr system, by Analytik Jena (1 mentions)
Vahts mrna seq v2 library prep kit, by Illumina (1 mentions)
Sybr premix ex taq kit, by Takara Bio (1 mentions)
Primescript 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Dnase 1, by Takara Bio (1 mentions)
Hiscript 2 1st strand complementary dna cdna synthesis kit, by Vazyme (1 mentions)
8 protocols using plant rna kit
1
Quantifying Plant Gene Expression
2
Transcriptome Sequencing of Wild-type and Mutant Plant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of the two groups (WT and wl) was extracted using a Plant RNA Kit (TaKaRa, Tokyo, Japan) following the manufacturer’s instructions. The quality and quantity of the total RNA were assessed at absorbance ratios of OD260/280 and OD260/230 and with 1% agarose gel electrophoresis. The replicates were mixed to produce 2 pooled samples for the sequencing analysis. After mRNA-seq libraries were generated using the VAHTS mRNA-seq v2 Library Prep Kit for Illumina (Vazyme, NR601, Nanjing, China) following the manufacturer’s recommendations and the library concentration was measured using the Qubit® RNA Assay Kit in Qubit® 3.0 for preliminary quantification. The insert size was assessed using the Agilent Bioanalysis 2100 system and found to be consistent with expectations; then, the qualified insert size was accurately quantified using qPCR with the StepOnePlus Real-Time PCR system (ABI, Norwalk, CT, USA). The clustering of the index-coded samples was performed on a cBot Cluster Generation System (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions. After cluster generation, the libraries were sequenced on an Illumina HiSeq X Ten platform with the 150 bp paired-end module.
3
Drought and Salt Stress Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of all samples was isolated using the plant RNA Kit (TAKARA, Xining, China), and then cDNA was synthesized by a PrimeScript™ RT reagent Kit (TAKARA, Xining, China). The 16 AsWRKYs were selected to validate the expression level under drought and salt stress and primers, as listed in Table S1 . qRT-PCR was performed on Light Cycle96 with TB Green® Premix Ex Taq™ II (TAKARA, Xining, China), and the PCR program was conducted as follows: 10 s at 95 °C, 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Each reaction had three biological replicates, and data were analyzed by the 2−ΔΔCT method.
4
Quantifying AsPYL Gene Expression under Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted using the plant RNA Kit (Takara, Shiga, Japan), the cDNA was synthesized using a PrimeScript™ RT reagent Kit (Takara, Shiga, Japan). The 10 AsPYL genes were selected to validate the expression level under salt and drought stress and primers, as listed in Supplemental File 1 . qRT-PCR was carried out on Light Cycle96 with TB Green® Premix Ex Taq™ II (Takara, Shiga, Japan), the PCR conditions was conducted as follows: 30 s at 95 °C, 40 cycles of 95 °C for 5 s and 60 °C for 40 s. The relative expression levels of AsPYL genes were analyzed by the 2−ΔΔCT method (Livak & Schmittgen, 2013 (link)).
5
Quantitative Analysis of Soybean Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from germinated soybeans using a Takara Plant RNA Kit (Code No. 9769, Takara, China). For the synthesis of first-strand cDNA, certain amount of total RNA was reverse-transcribed using a PrimeScript RT reagent Kit (Code No. DRR037A, Takara, China). The sequence-specific primers used in this study for qRT-PCR analysis are listed in Table 1 . For each sample, three replications of PCR were performed for real-time quantitative assays using SYBR Premix Ex Taq kit (Code No. RR420A, Takara:) in an ABI sequence detection system (model 7500, Applied Biosystems, CA, USA).
The primers used for QRT-PCR.
| Gene | Primer name | Primer sequences |
|---|---|---|
| NADPH | Sense | TTGGGGTTTTCTATTGTGGACC |
| Anti-sense | GCTTCAACAGATATGTTCCATCAGA | |
| PAL | Sense | CTACCATCACCAATGGGAGCC |
| Anti-sense | CTCCCCAGTTTAACGGATCACT | |
| CHS | Sense | GCTTGTTGTCTGTTCTGAG |
| Anti-sense | CACCTTCACTGTCTGGAG | |
| IFS1 | Sense | GAGAGCTGGCCTCACAGTTC |
| Anti-sense | TGCGATGGCAAGACACTACT | |
| IFS2 | Sense | TGGAAGTTCGTGAGGAAG |
| Anti-sense | ATGGAGATGGTGCTGTTG |
6
Total RNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of the two groups (control (LV) and albino mutant (HUA)) was extracted using a Plant RNA Kit (TaKaRa, Japan) following the manufacturer's instructions. The quality and quantity of the total RNA were assessed at absorbance ratios of OD 260/280 and OD 260/230 and with 1% agarose gel electrophoresis. The replicates were mixed to produce 2 pooled samples for the sequencing analysis. After mRNA-seq libraries were generated using the VAHTS mRNA-seq v2 Library Prep Kit for Illumina (Vazyme, NR601) following the manufacturer's recommendations, the library concentration was measured using the Qubit® RNA Assay Kit in Qubit® 3.0 for preliminary quantification. The insert size was assessed using the Agilent Bioanalysis 2100 system and found to be consistent with expectations; then, the qualified insert size was accurately quantified using qPCR with the StepOnePlus Real-Time PCR system (ABI, USA). The clustering of the index-coded samples was performed on a cBot Cluster Generation System (Illumina, USA) according to the manufacturer's instructions. After cluster generation, the libraries were sequenced on an Illumina HiSeq X Ten platform with the 150 bp paired-end module.
7
Quantifying Gene Expression in Plant Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Root, stem, leaf, flower, and fruit pod’s tissues were collected. Then, total RNA was extracted from different plant materials using RNA Plant Kit (Takara, Qingdao, China), and then reverse transcription was conducted using the PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara, Qingdao, China) to get genome DNA. Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed with 20-µL volume using SYBR qPCR Master Mix (Vazyme, Nanjin, China). The internal reference gene for qRT–PCR was Bj18s; Table S1 lists gene-specific primers.
Three replicate samples of each period were subjected to three biological replicates using the BioRad IQ5 Real-Time PCR instrument (BioRad Laboratories, Hercules, CA, USA). Amplification parameters were as follows: activation at 50 °C for two minutes, predenaturation at 95 °C for two minutes, denaturation at 95 °C for 15 s, and annealing at 60 °C for one minute for 40 cycles. Finally, the relative gene expression level was calculated using the 2−ΔΔCt method [58 (link)].
Three replicate samples of each period were subjected to three biological replicates using the BioRad IQ5 Real-Time PCR instrument (BioRad Laboratories, Hercules, CA, USA). Amplification parameters were as follows: activation at 50 °C for two minutes, predenaturation at 95 °C for two minutes, denaturation at 95 °C for 15 s, and annealing at 60 °C for one minute for 40 cycles. Finally, the relative gene expression level was calculated using the 2−ΔΔCt method [58 (link)].
8
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from different plant materials using RNA Plant Kit (Takara, Qingdao, China) and treated with DNase I (Takara, Qindao, China) to remove genomic DNA. Reverse transcription was performed using the HiScript II 1st strand complementary DNA (cDNA) synthesis kit (Vazyme, Nanjing, China). qRT-PCR was performed using a 20 μL reaction volume comprising 10 μL SYBR qPCR Master Mix (Vazyme), 6.4 μL of ddH2O, 0.8 μL of forward primer (10 μmol/L), 0.8 μL of reverse primer, and 2 μL of template cDNA. Nt36s was used as the internal reference gene for qRT-PCR. The gene-specific primers are listed in Table S1
Three replicates corresponding to each period were subjected to amplification using Bio-Rad IQ5 Real-Time PCR instrument (Bio-Rad Laboratories, Hercules, CA, USA). The amplification parameters were as follows: activation at 50°C for 2 min, predenaturation at 95°C for 2 min, denaturation at 95°C for 15 s, and annealing at 60°C for 1 min (40 cycles). Finally, the relative gene expression was calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001 (link)).
Three replicates corresponding to each period were subjected to amplification using Bio-Rad IQ5 Real-Time PCR instrument (Bio-Rad Laboratories, Hercules, CA, USA). The amplification parameters were as follows: activation at 50°C for 2 min, predenaturation at 95°C for 2 min, denaturation at 95°C for 15 s, and annealing at 60°C for 1 min (40 cycles). Finally, the relative gene expression was calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!