The largest database of trusted experimental protocols

Rna isolater kit

Manufactured by Vazyme
Sourced in China

The RNA isolater kit is a laboratory equipment designed for the extraction and purification of ribonucleic acid (RNA) from various biological samples. It provides a reliable and efficient method to obtain high-quality RNA for downstream applications such as reverse transcription and gene expression analysis.

Automatically generated - may contain errors

3 protocols using rna isolater kit

1

RNA Extraction and qRT-PCR Analysis in Rice

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total rice RNA was extracted from the roots, stems, leaves, sheaths, and young panicles with an RNA isolater kit (Vazyme), and the first-strand cDNA was reverse transcribed using a reverse transcription kit (Vazyme). The quantitative real time RT-PCR (qRT-PCR) analysis was conducted with a real-time PCR system (qTOWER3 G, analytikjena, Jena, Germany). The Actin 1 gene was chosen as a reference gene. Three biological replicates were carried out in each experiment, and Student’s t test was used for the statistical analysis. All of the primers used in the qRT-PCR analysis are listed in Table S2 [55 (link),56 (link),57 (link),58 (link)].
+ Open protocol
+ Expand
2

Quantitative Analysis of TRIB3 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total mRNA was extracted using the RNA isolater kit (Vazyme Biotech Co., Ltd, China) following the manufacturer's protocol. The extracted total mRNA was then reversely transcribed into cDNA using the HiScript II Q RT SuperMix for qPCR kit (Vazyme, China), followed by RT-PCR amplification using ChamQ Universal SYBR qPCR Master Mix (Vazyme, China) with GAPDH serving as the reference gene. Data analysis was performed using the 2−ΔΔCT method. The forward and reverse primers used are as follows:
TRIB3-F: TGCGTGATCTCAAGCTGTG;
TRIB3-R: CTTGTCCCACAGGGAATCA.
GAPDH-F: GTCTCCTCTGACTTCAACAGCG;
GAPDH-R: ACCACCCTGTTGCTGTAGCCAA.
+ Open protocol
+ Expand
3

Quantitative RT-PCR Analysis of Rice Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rice samples were harvested from 7 to 8 a.m. Total rice RNA from root, leaf, leaf sheath, young panicle and stem was extracted with a RNA isolater kit (Vazyme). The first-strand cDNA was reverse transcribed from total RNA (2 μg) by using a reverse transcription kit (Vazyme). The amplification was performed in a total volume of 10 μL with 0.1 μM of each primer and 1 × SYBR green PCR master mix (Vazyme) by using the CFX96 real-time PCR system (Bio-Rad). The reaction condition was as follow: 95 °C for 3 min, then 40 cycles of 95 °C for 10 s and 55 °C for 30 s. More than 3 plants were mixed for each sample. For each sample, three technical replicates on each of three biological replicates were carried out. The Actin 1 gene was chosen as an internal control. The 2-ΔΔCT method was used to calculate relative changes in gene expression. The Student’s t test was used for statistical analysis. All qRT-PCR primer sets were listed in Additional file 16: Table S5.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!