Rna isolater kit
The RNA isolater kit is a laboratory equipment designed for the extraction and purification of ribonucleic acid (RNA) from various biological samples. It provides a reliable and efficient method to obtain high-quality RNA for downstream applications such as reverse transcription and gene expression analysis.
Lab products found in correlation
3 protocols using rna isolater kit
RNA Extraction and qRT-PCR Analysis in Rice
Quantitative Analysis of TRIB3 Expression
TRIB3-F: TGCGTGATCTCAAGCTGTG;
TRIB3-R: CTTGTCCCACAGGGAATCA.
GAPDH-F: GTCTCCTCTGACTTCAACAGCG;
GAPDH-R: ACCACCCTGTTGCTGTAGCCAA.
Quantitative RT-PCR Analysis of Rice Tissues
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!