cDNAs encoding mutated and wild type forms of KCNJ5 were prepared by Gateway cloning (ThermoFisher Scientific) in cumate inducible PiggyBac vectors (System Biosciences, Palo Alto, CA). Stable cell lines were established by co-transfection of human adrenocortical cells (HAC15 cells, a kind gift from Professor William E. Rainey, University of Michigan, Ann Arbor, USA) with the PiggyBac vector (carrying the human KCNJ5 cDNA) and the Super PiggyBac transposase according to the manufactureŕs instructions (System Biosciences, Palo Alto, CA). Transfected cells were selected with puromycin (4 μg/mL) in the presence of verapamil (10 μM) to inhibit the P glycoprotein.22 (link) The macrolide antibiotic roxithromycin (20 μM) was also included to inhibit any potential effects on cell growth of mutant KCNJ5 channels23 (link) in the absence of the cumate inducer. Total RNA was extracted from stable cell lines after induction with cumate (10 μg/mL) for 72 h, reverse transcribed and the KCNJ5 gene was sequenced to confirm the mutated or wild-type KCNJ5 genotype of all cell lines.21 (link)
Piggybac vector
Manufactured by System Biosciences
Sourced in United States
The PiggyBac vector is a transposon-based gene delivery system that enables the stable integration of genetic material into the host genome. It facilitates the efficient insertion and expression of transgenes in a wide range of cell types and organisms.
Automatically generated - may contain errors
Lab products found in correlation
Piggybac transposase, by System Biosciences (6 mentions)
Super piggybac transposase, by System Biosciences (6 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions)
Ptre tight, by Takara Bio (4 mentions)
Piggybac transposon vector, by System Biosciences (4 mentions)
Pgl4.10 luciferase, by Promega (4 mentions)
Puc19, by New England Biolabs (4 mentions)
Pb210pa 1, by System Biosciences (4 mentions)
Gateway cloning, by Thermo Fisher Scientific (3 mentions)
Px458 vector, by Addgene (2 mentions)
Rpa t8, by BioLegend (2 mentions)
Facsaria 2, by BD (2 mentions)
Facsaria, by BD (2 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (2 mentions)
Sc119919, by System Biosciences (2 mentions)
Cumate, by Merck Group (2 mentions)
Pci empty vector, by Promega (2 mentions)
Ecl detection kit, by GE Healthcare (1 mentions)
Radiolabeled 59fecl3, by PerkinElmer (1 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
12 protocols using piggybac vector
1
Generating Stable Cell Lines Expressing Mutant KCNJ5
2
Generating GFP-TCOF1 and GFP-DDX21 Constructs
3
Profiling Antigen-Specific T Cell Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cryopreserved PBMCs were stained with NF9/A24 and QI9/A24 tetramers, anti-CD8 mAb (RPA-T8; Biolegend), and 7-amino-actinomycin D (7-AAD), and then tetramer+CD8+7-AAD− cells were sorted into 96-well plates (NIPPON Genetics, Cat# 4ti-0770/C) by using an FACS Aria II (BD Biosciences). TCRα and TCRβ cDNA pairs were amplified from single T cells by a one-step multiplex RT-PCR method described in our previous study16 (link). The DNA sequences of the PCR products were then analyzed by direct sequencing and the TCR repertoire by IMGT/V-QUEST (https://www.imgt.org/IMGT_vquest/vquest ). The amplified TCRα and TCRβ cDNA fragments were connected to the missing constant region and linked to the blasticidin-S resistance (BlaR) gene by the Gibson assembly method with P2A ribosomal skipping sequences. Resultant TCRβ-P2A-TCRα-P2A-BlaR DNA was cloned into the PiggyBac vector (SBI, Cat# PB530A-2) by the Gibson assembly method.
4
Inducible Claudin CRISPR Knockdown in MDCK Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EGFP-claudin-2, 7, 15 and 19 were expressed using the EF1α promoter. A PiggyBac vector (System Biosciences) into which a TET-ON3G gene expression system (Clontech) had been incorporated was used for inducible mCherry-claudin-4 expression. Fluorescence-activated cell sorting (FACS Aria, BD Biosciences) was used to sort the top 5–20% GFP-positive cells where polyclonal cell populations were used.
Guide RNA targeting canine Cldn4 gene exon 2 (5’- GCTGGCCGGCCTGCTGGTCA -3’) was cloned into pSpCas9(BB)-2A-Puro vector and transfected into MDCK I cells. After 5 days of puromycin (10 µg/mL) selection, clones were isolated by limiting dilution in 96-well plates and characterized by immunostaining, western blot, and genomic DNA sequencing.
Guide RNA targeting canine Cldn4 gene exon 2 (5’- GCTGGCCGGCCTGCTGGTCA -3’) was cloned into pSpCas9(BB)-2A-Puro vector and transfected into MDCK I cells. After 5 days of puromycin (10 µg/mL) selection, clones were isolated by limiting dilution in 96-well plates and characterized by immunostaining, western blot, and genomic DNA sequencing.
5
mCherry-PDEδ Construct Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eight silent point mutations were introduced into the targeting region of the PDEδ shRNA of a previously published mCherry‐PDEδ construct9 using Q5® Site‐Directed Mutagenesis Kit (New England BioLabs, NEB, Frankfurt, Germany) according to the manufacturer's protocol. After sequence validation, the mutated mCherry‐PDEδ construct was cloned into a PiggyBac vector (System Bioscience, Palo Alto, CA) utilizing the restriction enzymes SpeI and NotI (NEB). Afterwards, HCT‐116 cells were co‐transfected with the above described construct and a PiggyBac transposase (System Bioscience, ratio 1:1) to enable genome integration. Stable transfected cells were selected by fluorescence activated cell sorting (FACS) based on mCherry fluorescence one week after transfection.
6
Engineered Axl CAR and synNotch Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Axl CAR was designed by fusing humanized Axl scFv to the hinge region of the human CD8α chain and transmembrane and cytoplasmic regions of the human CD28, 4–1BB, and CD3ζ signaling endodomains. They were under SFFV promoter for primary T cell experiments and under CAG promoter for Jurkat cell experiments. Axl synNotch receptor was designed by fusing humanized Axl scFv to the notch core intracellular domain fused to tTA transcription factor. Both Axl CAR and Axl synNotch contain a myc tag for verifying surface expression. Furthermore, the Axl CAR used in human primary T cell experiments was fused to a mCherry after the CD3ζ chain for expression level quantification. The Axl CAR used in Jurkat experiments was cloned into the PiggyBAC vector (System Bioscience Inc.), which has been modified by replacing the CMV promoter with a CAG promoter.
7
Modular Inducible Genetic Cargo System
8
Plasmid Overexpression of α-Synuclein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid expressing α-syn has been described before30 (link). Briefly the human α-syn cDNA encoding plasmid was purchased from Origene, USA (SC119919) and subcloned in piggybac vector (Systems Biosciences, CA, USA). Rab1a (#46776) and dual tagged LC3-GFP-mCherry (#22418) plasmids were procured from Addgene, MA, USA.
9
Engineered EGFR Constructs for Cell Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EGFR mutation constructs were generated by in-fusion cloning. The backbone of all constructs were essentially as described [13] (link), with eGFP cloned in-frame 3’ to the transmembrane domain. This position was chosen to avoid potential interference with ligand binding or receptor internalization signaling sites. Constructs were cloned into a piggybac vector (System Biosciences, Palo Alto, Ca) allowing for rapid integration using transposase into the host genome. Cell-lines were obtained from the ATCC (Manassas, Virginia). Cells were plated in 96 or 384 well plates for further analysis.
10
Modular Inducible Genetic Cargo System
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pTETRIS-Cargo vector was created from components of a cumate-inducible piggyBAC transposon vector (System Biosciences), pGl4.10-Luciferase (Promega), and pTRE-Tight (Clontech). Briefly, a 567bp fragment containing a minimal mouse PGK promoter was cloned into a SacI site in pGl4.10-Luciferase to generate pGI4-PGK-Luc-pA. The reverse complement of PGK-Luc-pA was cloned into a vector containing the bovine growth hormone polyA site. The entire bGHpa-[reversePGK-Luc-pA] was cloned into NotI and SalI sites of the piggyBAC vector (System Biosciences). The cumate-inducible promoter in the piggyBAC vector was then replaced with the Tetracycline Responsive Element (TRE) from pTRE-Tight (Clontech) via Gibson assembly to generate pTETRIS-Cargo in Fig. 4A , in which the lncRNA, the luciferase gene, and a gene encoding puromycin resistance are all flanked by chicken HS4 insulator elements, and inverted terminal repeats (ITRs) recognized by the piggyBAC transposase. The rtTA-cargo vector from Fig. 4A was generated by cloning the hUbiC-rtTA3-IRES-Neo cassette from pSLIK-Neo (Addgene Plasmid #25735) into SfiI and SalI sites in a piggyBAC transposon vector (System Biosciences). The piggyBAC transposase from System Biosciences was cloned into SmaI and HindIII sites into pUC19 (NEB) to allow propagation of the transposase on ampicillin plates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!