Total RNA was extracted from cultured cells using TRIzol Reagent (Invitrogen, USA), and cDNA was synthesized using PrimeScript RT Reagent Mix (Takara Bio, USA) according to the manufacturer's instructions. qPCR was performed using SYBR Green PCR Master Mix (Life Technologies, USA) and an ABI 7500 real-time PCR system (Applied Biosystems, USA). The levels of targets were normalized to those of ACTB and to those of control samples. The primers for qPCR are listed in Supplementary Table S1 .
Primescript rt reagent mix
Manufactured by Takara Bio
Sourced in China
PrimeScript RT Reagent Mix is a reagent kit designed for reverse transcription (RT) of RNA into complementary DNA (cDNA). The kit includes all the necessary components for the RT reaction, including the PrimeScript Reverse Transcriptase enzyme, buffer, and RNase inhibitor.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by CWBIO (1 mentions)
Ultrasybr mixture, by CWBIO (1 mentions)
Rnase r, by Illumina (1 mentions)
Mirna first strand cdna synthesis, by Sangon (1 mentions)
4 protocols using primescript rt reagent mix
1
Quantitative PCR protocol for gene expression
2
Extraction and Quantification of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol reagent (15596018; Invitrogen), genomic DNA was removed, and the complementary DNA (cDNA) was synthesized with the PrimeScript™ RT reagent Mix (RR0047A; TAKARA). The reverse-transcribed product was diluted and utilized to amplify the genes of interest (GAPDH served as the internal reference; primers listed in S1 Table ). Tissues obtained from more than 3 different animals in each group were analyzed.
3
Quantitative Analysis of H19 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted utilizing TRIzol reagent (CWBIO, China). cDNA was obtained via PrimeScript RT Mix reagent (Takara, China). Real-time PCR was conducted with Quantity Nova SYBR Green PCR Master Mix (QIAGEN, Germany), and β-actin was used as an internal reference. All procedures were completed in the QuanStudio 5 Real-time PCR system (Therom Lifetech ABI, USA). The primers of H19 were as follows:
Fw: 5′TCCTGAACACCTTAGGCTGG3′
Rev: 5′TGATGTTGGGCTGATGAGGT3′
Fw: 5′TCCTGAACACCTTAGGCTGG3′
Rev: 5′TGATGTTGGGCTGATGAGGT3′
4
Circular RNA Detection and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (Invitrogen, USA). In order to verify the circular character, 1 μg of total RNA was incubated 30 min at 37 °C with/without 1 U/μg of RNase R (Epicentre, USA) and 65 °C for 20 min to kill enzyme activity. To quantify the amount of mature miRNA, we used miRNA First Strand cDNA Synthesis (Sangon, China) and U6 as an endogenous control. To quantify the amount of mRNA and circRNA, cDNA was synthesized from 1 μg of RNA by PrimeScript RT Mix reagent (Takara, China) and GAPDH was used as internal control. Real-time PCR was performed using UltraSYBR mixture (Cwbiotech, China). All analyses were performed using the QuantStudio 5 Real-Time PCR System (Thermo Lifetech ABI, USA). The relevant primers are listed in Additional file 2 : Table S1 and Additional file 8 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!