Primescript rt reagent mix
PrimeScript RT Reagent Mix is a reagent kit designed for reverse transcription (RT) of RNA into complementary DNA (cDNA). The kit includes all the necessary components for the RT reaction, including the PrimeScript Reverse Transcriptase enzyme, buffer, and RNase inhibitor.
Lab products found in correlation
4 protocols using primescript rt reagent mix
Quantitative PCR protocol for gene expression
Extraction and Quantification of Gene Expression
Quantitative Analysis of H19 Expression
Fw: 5′TCCTGAACACCTTAGGCTGG3′
Rev: 5′TGATGTTGGGCTGATGAGGT3′
Circular RNA Detection and Quantification
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!