The total RNA in the retinal pigment epithelium (RPE)-choroid complex from mice was isolated using the
NucleoSpin RNA kit (Takara, Shiga, Japan) per the information from the manufacturer’s protocol. Also, the total RNA from ARPE-19 cells was performed in the same manner. The RNA concentration was measured by using
NanoVue Plus (GE HealthCare Japan, Tokyo, Japan), and cDNA was synthesized by
PrimeScript RT Reagent kit (Takara). To determine the
S1p1 and VEGF mRNA expression,
SYBR Premix Ex TaqII (Takara) and
TP8000 Thermal Cycler Dice Real-Time system (Takara) were used. For housekeeping, the expression of
β-actin was used.
The PCR primer sequences for murine tissues used were:
S1p1 forward, 5′-CACCGGCCCATGTACTATTT-3′ and reverse, 5′-GACTGCCCTTGGAGATGTTC-3′ and
β-actin forward: 5′-TCAAGATCATTGCTCCTCCTG -3′, reverse: 5′- CTGCTTGCTGATCCACATCTG -3′.
The PCR primer sequences for human cells used were:
Vegf forward, 5′-TCTACCTCCACCATGCCAAGT-3′ and reverse, 5′-GATGATTCTGCCCTCCTCCTT -3′ and
β-actin forward: 5′-TCAAGATCATTGCTCCTCCTG-3′, reverse: 5′-CTGCTTGCTGATCCACATCTG-3′.
Nakamura S., Yamamoto R., Matsuda T., Yasuda H., Nishinaka A., Takahashi K., Inoue Y., Kuromitsu S., Shimazawa M., Goto M., Narumiya S, & Hara H. (2024). Sphingosine-1-phosphate receptor 1/5 selective agonist alleviates ocular vascular pathologies. Scientific Reports, 14, 9700.