Takara primescript rt reagent

The mRNA levels of adipokines and lipometabolism-related genes were detected. Total RNA was isolated from epididymal fat tissues or adipocytes with TRIzol Reagent (Invitrogen, Carlsbad, USA). Then the Takara primescript™ RT reagent (Takara Biotechnology Co., Ltd., Dalian, China) was used to reverse transcribe 1 ng RNA. With Quantum Studio™ real-time PCR software, SYBR Green (TOYOBO Biotechnology Co., Ltd., Shanghai, China) was used for RT-qPCR. The target gene primer pairs were synthesized by Tsingke Biotechnology Co., Ltd. (Beijing, China). The primer sequence was shown in Supplementary Table 1 (27 (link)–29 (link)). The 2^−ΔΔCt method was used to determine the relative gene expression (30 (link)).

Total RNA was extracted from cells using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. Takara PrimeScript RT reagent (Takara Bio, Inc) was used to synthesize the first‐strand cDNA. Following this, we used the SYBR Green PCR reagent kit (Takara Bio, Inc) to perform qRT‐PCR assay following the manufacturer's instructions. β‐actin was used as an internal control. The qRT‐PCR primer sequences in this study were used as IGF1 Forward Primer 5′‐GCTCTTCAGTTCGTGTGTGGA‐3′, Reverse Primer 5′‐GCCTCCTTAGATCACAGCTCC‐3′; MMP‐2 Forward Primer 5′‐TGACTTTCTTGGATCGGGTCG‐3′, Reverse Primer 5′‐AAGCACCACATCAGATGACTG‐3′; MMP‐9 Forward Primer 5′‐TGTACCGCTATGGTTACACTCG‐3′, Reverse Primer GGCAGGGACAGTTGCTTCT; β‐Actin Forward Primer 5′‐GTTGAGAACCGTGTACCATGT‐3′, Reverse Primer 5′‐TTCCCACAATTTGGCAAGAGC‐3′.

Total RNA from several tissues (liver, white/brown adipose tissues, and intestinal segments) were extracted using TRI-Reagent (Sigma Aldrich, ref #T9424), in accordance with the manufacturer’s instructions. First-strand cDNAs were synthesized from 1 µg of total RNAs using TAKARA Prime Script™ RT Reagent (TAKARA Bio, ref #RR037A). Purity and concentration of RNAs were determined using NanodropOne (Ozyme, Saint-Cyr-L’Ecole, France), and the quality was checked by using a Bioanalyser (Agilent Technologies, Santa Clara, United-States). Real-time PCR assays were performed with Rotor-Gene Q (Qiagen, Hilden, Germany) using SYBR® Premix Ex-Taq™ (TAKARA Bio, ref #RR420L). TATA-box binding protein (TBP) was used as a reference gene to normalize the results, as previously reported.^{64 (link)} Primers are listed in Supplementary Table S3.