Polyclonal antibodies for yap

Fragmented chromatin from cancer cells was incubated with anti-IgG (negative control) and anti-YAP. Recruited DNA was subjected to PCR using the primers for distal enhancer regions of PD-L1, and PCR products were electrophoresed in agarose gel. The ChIP assay was conducted using the ChIP Assay Kit (Millipore Corporation). Polyclonal antibodies for YAP (Cell Signaling Technology) and control rabbit antibody for IgG (Cell Signaling Technology) were used for ChIP. Primers were used for RT-PCR to amplify the PD-L1 gene.

Fragmented chromatin from H2052 cells was incubated with anti‐IgG (negative control), anti‐YAP and anti‐POL‐II (positive control). Recruited DNA was subjected to PCR using the primers for distal enhancer regions of PD‐L1, and PCR products were electrophoresed in agarose gel. The ChIP assay was conducted using the Chromatin Immunoprecipitation (ChIP) Assay Kit (Millipore Corporation). Polyclonal antibodies for YAP (Cell Signaling Technology) and control rabbit antibody for IgG (Cell Signaling Technology) were used for ChIP. Two‐pair primers were used for RT‐PCR to amplify the PD‐L1 gene. One pair consisted of 5′‐TCGGTCTGTGAAGGACTGC‐3′ and 5′‐ACCGTTGAGGAATGGATGAA‐3′, resulting in a product size of 203 bp, and the other consisted of 5′‐CCACCACCATTATCTAATTCCA‐3′and 5′‐AAGGAGCCAGACACAAAAGG‐3′, resulting in a product size of 210 bp.

The ChIP assay was conducted using the Chromatin Immunoprecipitation (ChIP) Assay Kit (Millipore Corporation). Polyclonal antibodies for YAP (Cell Signaling Technology) and control rabbit antibody for IgG (Cell Signaling Technology) were used for ChIP. Primers used for RT-PCR to amplify the ABCG2 gene were 5′-GGTACTGATCAGCCCAATGA-3′ and 5′- TGCGACCCGGCTGAAAGCGC-3′, resulting in a product size of 202 bp. Primers used for quantitative PCR to detect ABCG2 were 5′-GGTACTGATCAGCCCAATG A-3′ and 5′-CAGGGACAAGCCAAACACT-3′. This Q-PCR analysis was performed using Qiagen SYBR Green/Rox qPCR Master Mix (Qiagen) and Applied Biosystems 7000 sequence detection system (Applied Biosystems, Foster City, CA).