For total RNA isolation from CRC tissues and cell lines, RNeasy mini kits (Zymo Research, Irvine, CA, USA) were used as described previously [31 ]. RNA was converted into cDNA using Superscript III Reverse Transcriptase (Invitrogen), followed by qPCR using SYBR green and primers synthesized by Integrated DNA Technologies (Coralville, IA, USA) to determine the mRNA expression of TRIP13, COL6A3, TREM2, SHC3, and KLK7 in CRC cells and tissues. β‐Actin was used as a normalizing control. A list of primers used in this study is given in Table S2 .
Rneasy mini kit
Manufactured by Zymo Research
Sourced in United States, Canada, Germany
The RNeasy Mini Kit is a laboratory equipment product designed for the purification of RNA from various sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify RNA molecules. The kit includes necessary buffers, spin columns, and other components required for the RNA extraction process.
Automatically generated - may contain errors
Lab products found in correlation
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Set b, by Illumina (2 mentions)
Ds 11, by DeNovix (2 mentions)
High capacity cdna kit, by Thermo Fisher Scientific (2 mentions)
Minion sequencer, by Oxford Nanopore (2 mentions)
Lunascript rt supermix, by New England Biolabs (2 mentions)
Native barcoding expansion 96 kit, by Oxford Nanopore (2 mentions)
Dna rna mini kit, by Zymo Research (2 mentions)
Quick rna miniprep kit, by Zymo Research (1 mentions)
Iq sybr green supermix, by Bio-Rad (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Sybr green dye, by Qiagen (1 mentions)
Sybr green supermix, by Bio-Rad (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Dnase, by Qiagen (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
Direct zol rna miniprep kit, by Qiagen (1 mentions)
Rt2 profiler pcr array, by Qiagen (1 mentions)
Direct zol rna miniprep kit, by Zymo Research (1 mentions)
16 protocols using rneasy mini kit
1
RNA Isolation and qPCR Analysis of CRC Genes
2
Measurement of mRNA Expression in CRC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNeasy mini kits (Zymo Research, Irvine, CA, USA) were used to isolate total RNA from CRC tissues and cell lines. Superscript III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) was utilized to convert RNA into complementary DNA. SYBR green qPCR was performed with primers synthesized by Integrated DNA Technologies (Coralville, IA) to determine the mRNA expression of genes as described [56 (link)]. ACTB was used as a normalizing control, and the data were analyzed using the 2^(-ΔΔCt) method. A list of primers is in Table S5 .
3
RNA Extraction and cDNA Synthesis for qRT-PCR
4
Neuronal RNA Isolation for RT-qPCR and RNA-seq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was collected from each transduction at 11 DIV for both RT-qPCR and RNA-seq. RNA for RT-qPCR was isolated from neurons using a Qiagen RNeasy mini kit (74004) or a Zymo Quick-RNA miniprep kit (R1054).
5
Quantifying SOX2 mRNA in Glioblastoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR analysis was used to determine the mRNA expression level of SOX2 in parental, TMZ-resistant, and metformin treated glioblastoma cells. Total RNA was extracted from cells using RNeasy Mini Kit (Zymo Research). cDNA synthesis was accomplished using SuperScript III First-Strand Synthesis System (Life Technologies) following the manufacturer's instructions. Quantitative PCR was performed by using iQ™ SYBR® Green Supermix (Bio-Rad) in 7900HT Fast Real-Time PCR System (Applied Biosystems). Gene expression levels were compared after normalization to endogenous GAPDH. The primer sequences used in this study are illustrated in Supplementary Table S6 . Experiments were performed in triplicate, and the results were calculated with the 2−ΔΔCt method.
6
Liver Transcriptome Analysis Using RNA-Seq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Liver was homogenized and RNA from liver or cells was extracted using Direct-zol RNA MiniPrep (cat. no. R2050; Zymo Research, Irvine, CA) or the RNeasy Mini Kit (cat. no. 74104; Qiagen, Hilden, Germany).
cDNA libraries for all samples were created using the TruSeq RNA Sample Prep Kit v2–48, Set A (cat. no. RS-122-2001; Illumina, San Diego, CA) and Set B (cat. no. RS-122-2002; Illumina). For specifics, seeSupplementary Materials .
cDNA libraries for all samples were created using the TruSeq RNA Sample Prep Kit v2–48, Set A (cat. no. RS-122-2001; Illumina, San Diego, CA) and Set B (cat. no. RS-122-2002; Illumina). For specifics, see
7
Renin Transcript Quantification via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the RNeasy Mini Kit (Zymo Research, Freiburg, Germany) according to the manufacturer’s instructions. Quality was checked by spectrophotometry (DS-11 + , DeNovix Inc, Wilmington, USA). High Capacity cDNA Kit (Life Technologies, Darmstadt, Germany) was used for reverse transcribing RNA to cDNA, which was stored at −70 °C. For qPCR, cDNA was diluted in nuclease-free water. Duplicates of 20 ng cDNA were mixed either with SYBR® FAST Universal 2X Master Mix containing SYBR green dye (Qiagen, Hilden, Germany) or with Blue 5′Green qPCR 2X Mix (Biozym, Hilden, Germany) and optimized primer pairs for the different renin transcripts and the housekeeping gene tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta (YWHAZ) (Table 1 ). The threshold cycle number (CT) in combination with the 2−∆CT method was normalized against YWHAZ.
Primer sequences for detection of transcript abundances.
| Transcript | Forward primer | Revers primer |
|---|---|---|
| Renin exon(1-9) | ATGAATTCACCCCATTCAGC | CCAGATGGGCGGGAGGAGGATG |
| Renin exon(1A-9) | TGAATTTCCCCAGTCAGTGAT | GAATTCACCCCATTCAGCAC |
| Renin exon(2-9) | GCTCCTGGCAGATCACCAT | CCTGGCTACAGTTCACAACGTA |
| YWHAZ | CATCTGCAACGACGTACTGTCTCT | GACTGGTCCACAATTCCTTTCTTG |
| VEGF | TGCCAAGTGGTCCCAG | CGCACACCGCATTAGG |
| PDK1 | CGGTGCCCCTGGCTGGATTT | GCATCCGTCCCGTAGCCCTC |
8
Nanopore Sequencing of SARS-CoV-2 Genomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
Extended Data Fig. 2 displays a flowchart outlining samples available for this study. Isolates with cycle threshold (Ct) values below 35 were selected for sequencing using the ARTIC v3 low-cost protocol targeting 400bp amplicons30 or Rapid Barcoding kit protocol targeting 1,200bp amplicons31 (link). Briefly, RNA was extracted using the Qiagen RNeasy Mini kit or Zymo DNA/RNA Mini kit. Reverse transcription was performed using LunaScript RT SuperMix (NEB). Tiling PCR was performed on the cDNA, and amplicons were barcoded using the Oxford Nanopore Native Barcoding Expansion 96 kit. Pooled barcoded libraries were then sequenced on an Oxford Nanopore MinION sequencer using R9.4.1 flow cells. Basecalling was performed in the MinKNOW software v21.02.1. Sequencing runs were monitored in real-time using RAMPART (https://artic-network.github.io/rampart/ ) to ensure sufficient genomic coverage with minimal runtime. Consensus sequence generation was performed using the ARTIC bioinformatics pipeline (https://github.com/artic-network/artic-ncov2019 ). Genomes were manually curated by visually inspecting sequencing alignment files for verification of key residues in Geneious v10.2.6.
+ Expand
9
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from FACS-sorted cells using RNeasy Mini Kit with on-column DNase treatment according to manufacturer’s protocol (Zymo Research, R1050). cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, 4368814) according to manufacturer’s instructions. Real-time PCR was performed using a SYBR Green Supermix (BioRad, 1725122) on a CFX96 RT-qPCR system, and data were analyzed using the 2 − ΔΔCT method. Primers used for qPCR are listed in Table S1 .
10
RNA Extraction and Quality Assessment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the QIAGEN RNeasy Mini kit or the Zymo DIRECT-ZOL RNA miniprep kit, with an additional DNase (QIAGEN) treatment. RNA quantity and integrity were determined using Nanodrop, agarose gels, and the Agilent 2100 Bioanalyzer.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!