Rtn350

RNA was isolated using a mammalian total RNA isolation kit (RTN350, Sigma) and treated with Dnase I (AMPD1, Sigma) according to the manufacturer’s instructions. Equal microgram volumes of RNA were reverse transcribed for each experimental condition by the use of a High-Capacity cDNA reverse transfection kit (4368813, ThermoFisher Scientific) with oligo dT (12577–011, ThermoFisher Scientific). The resulting cDNA was used for expression analysis performed with an Applied Biosystems real-time PCR system with TaqMan real-time PCR probes (Thermo Fisher). The TaqMan qPCR probes were as follows: COX6B2 (Hs00376070_m1), COX6B1 (Hs01086739_g1). RPL27 (Hs03044961_g1) was used as an internal loading assay for all expression assays.

Total RNA samples were purified from cells using a commercially available kit (RTN‐350; Sigma, St Louis, MO, USA) and RT‐qPCR was performed with Power SYBR Green RNA‐to‐CT TM 1‐Step kit (4389986; Applied Biosystems, Waltham, MA, USA). RT was carried out at 48°C for 30 min, and PCR conditions were 10 min at 95°C followed by 40 cycles of 15 s at 95°C and 1 min at 60°C using the appropriate forward and reverse primers, respectively (Sigma Aldrich): 5'‐AAGTCTCCCAGTCAGAACCG‐3' and 5'‐GTCCTGCACCTTCTCGATG‐3' (Fzr1, 0.2 µM; 5'‐TCAGCAATGCCTCCTGCACCA‐3' and 5'‐GCATGGACTGTGGTCATGAG‐3' (GAPDH, 0.3 µM). The mRNA levels of each transcript were normalized to the GAPDH mRNA abundance obtained from the same sample. The relative mRNA levels were calculated using the ΔΔCt method and were expressed as the fold change between sample and calibrator (Rodriguez et al. 2018).