Prior to RNA isolation, we purified sperm by filtering the semen samples with a 500-mesh sieve to eliminate cell debris. Then, samples were treated with a somatic cell lysis solution (0.3% Triton X-100 and 0.1% SDS in DEPC-treated H2O) for 30 min on ice to eradicate somatic cells, followed by microscopic analysis of non-sperm cell contamination. We isolated total RNA from the purified ram sperm (n = 4, for each group) samples using the SanPrep column microRNA miniprep kit (Bio Basic Inc, Canada) with slight modification using the manufacturer's protocols. We added 800 μl of a guanidine–thiocyanate lysis buffer enriched in 20 mM DL-dithiothreitol onto the pellet, and then sperm cells were homogenized by passing the samples through a 26-G needle syringe 20–25 times. After other contaminants were thoroughly removed and total RNA was attached to the membrane, an on-column DNase digestion was carried out to remove any traces of DNA contamination. We evaluated the concentration and integrity of the total RNA samples using a NanoDrop (Colibri Microvolume Spectrometer, Titertek-Berthold, Germany) and a 2100-Bioanalyzer with the RNA 2100 Nano Chip (Applied Biosystems, Carlsbad, CA, USA), respectively.
Nanodrop
Manufactured by Berthold Technologies
Sourced in Germany
The NanoDrop is a compact and efficient spectrophotometer designed for the measurement of small sample volumes. It allows for the quantification and analysis of various biomolecules, including DNA, RNA, and proteins, using only 1-2 microliters of sample.
Automatically generated - may contain errors
Lab products found in correlation
Sanprep column microrna mini prep kit, by Bio Basic (1 mentions)
Microvolume spectrometer, by Berthold Technologies (1 mentions)
2100 bioanalyzer, by Thermo Fisher Scientific (1 mentions)
Thermocycler, by Bio-Rad (1 mentions)
Icam1, by Qiagen (1 mentions)
Vcam1, by Qiagen (1 mentions)
β actin, by Qiagen (1 mentions)
E selectin, by Qiagen (1 mentions)
Animal tissue rna purification kit, by Norgen Biotek (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
Gapdh, by Qiagen (1 mentions)
Sensifast sybr no rox kit, by Meridian Bioscience (1 mentions)
G spin genomic dna extraction kit for bacteria, by iNtRON Biotechnology (1 mentions)
Gel doc xr system, by Bio-Rad (1 mentions)
Electrophoresis, by Merck Group (1 mentions)
5 protocols using nanodrop
1
Sperm RNA Isolation with Somatic Cell Removal
2
Molecular Identification of H. pylori Isolates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Initially, DNA was extracted from isolates by the boiling method.16 Therefore, the purity and quantity of the DNA were checked by NanoDrop (Berthold, Bad Wildbad, Germany). Then, in order to confirm H. pylori isolates, the detection of ureC gene was detected by PCR with listed primers in Table 1 . Polymerase chain reaction (PCR) reaction mixture was prepared in a total volume of 25 μL, containing 8 μL of deionized water, 12 μL of master mix PCR, 2 μL of primers (forward and reverse), and 3 μL of DNA template. Amplification was performed in a Bio‐Rad thermocycler. The PCR protocol for the detection of the desired genes is available in Table 2 .
3
Gene Expression Analysis of Liver and Kidney
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the liver (15 mg) and kidney (17 mg) using Animal Tissue RNA Purification Kit (#25700 Norgen Biotek Corporation, Thorold, ON, Canada) according to manufacturer’s instructions. The RNA concentration and purity were measured using a nanodrop (Titertek-Berthold) machine and 200 ng/µL (liver) or 120 ng/µL (kidney) were reverse transcripted. cDNA was prepared using the SensiFAST™ cDNA Synthesis Kit 50 reactions (#BIO-65053 Meridian Bioscience, USA) according to manufacturer’s instructions. Real time qPCR was performed using 100 ng of cDNA (liver and kidney) through the SensiFAST™ SYBR® No-ROX Kit (#BIO-98005 Meridian Bioscience, USA) according to manufacturer’s instructions. PCR reaction was carried out on the CFX Connect Real-Time PCR Detection System (Bio-Rad). Relative gene expression was obtained after normalization to housekeeping genes (β-actin and GAPDH) using the formula 2-ΔΔCT as previously described (36 (link)) and folds change was determined by comparison to Sham group. The QuantiTect primers β-actin (#QT00095242, Mm_Actb_1_SG), GAPDH (#QT01658692, Mm_GAPDH_3_SG), ICAM1 (#QT00155078, Mm_ICAM1_1_SG), VCAM1 (#QT00128793, Mm_VCAM1_1_SG), E-Selectin (#QT00114338, Mm_Sele_1_SG) used in this study were purchased from QIAGEN (Germantown, MD, EUA).
4
Bacterial DNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The bacterial strains were incubated in De Man, Rogosa and Sharpe (MRS) broth (MB Cell, South Korea) at 37°C for 24 h. The cells, obtained after centrifugation at 13,000 rpm for 1.5 min, were washed twice with 0.85% NaCl. Genomic DNA was then extracted from the washed cells using G-spin Genomic DNA Extraction Kit for bacteria (iNtRON Biotechnology, South Korea) following the manufacturer’s instructions. DNA concentration and purity were determined at an absorbance ratio of 260/280 nm using a Nanodrop (Titertek-Berthold, Germany).
5
Genomic DNA Extraction and PCR Amplification of mqsRA Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted using the genomic DNA extraction kit (WizPrep gDNA mini Kit; WizBio Solutions, Seongnam, South Korea) according to the manufacturer's protocol. DNA purity, quality and quantity were measured using a NanoDrop instrument (Titertek Berthold, Pforzheim, Germany). Total extracted DNAs of isolates were immediately stored at –20°C for further analysis. PCR were carried out using specific primers for amplifying mqsRA genes as described previously [25 (link)]. Subsequently, PCR products were observed using electrophoresis with 1% agarose gel stained by DNA safe on a Gel Doc XR+ system (Bio-Rad, Hercules, CA, USA). The sequences of the primers and conditions are listed in Table 1 . PCR products were analysed on 1% (weight/volume) agarose gels by electrophoresis (Merck, Darmstadt, Germany). PCR products were visualized under UV and photographed.Table 1
The sequences of the primers that were used in the PCR and Real Time PCR
| Gene | Primer sequence (5′→3′) | Denaturation temperature (°C) | Annealing temperature (°C) | Extension temperature (°C) | Cycle |
|---|---|---|---|---|---|
| mqsR | F: ACGCACACCACATACACGTT | 95 | 58.7 | 72 | 34 |
| R: GCCTGGGTCTGTAAACATCCT | |||||
| mqsA | F: AATGTCCGGTTTGCCACCAG | 95 | 58.7 | 72 | 34 |
| R: GCATTCACCGAAGCCCGAAA | |||||
| gyrB | F: CTGCTTCACCAACAACATCC | 95 | 58.7 | 72 | 34 |
| R: GGTGGCGATCTTGAACTTCT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!