Recombinant cas9 protein

All animal experiments were approved by the animal ethics committee of Kyushu University (A20-169-0, A21-271-0, and A22-013-0) and were conducted in compliance with the university guidelines and regulations for animal experimentation. For generation of Rpl3^–/– and Rpl3l^–/– mice, ribonucleoprotein was prepared by mixing the CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA) with recombinant Cas9 protein (Integrated DNA Technologies) (Supplementary Data 9). Mouse zygotes of the C57BL/6 J strain were subjected to electroporation with each ribonucleoprotein complex. All mice were housed in the specific pathogen-free animal facility at Kyushu University in accordance with institutional guidelines under the following conditions: ambient temperature of 22 °C, 50% to 60% humidity, 12 h-dark/12 h-light cycle, and free access to water and rodent chow CA-1 (CLEA Japan). Male mice were used for all experiments, given that male mice are commonly used for cardiac analysis. Mice were euthanized in a CO₂ chamber for experiments.

All animal experiments were approved by the animal ethics committee of Kyushu University (A20-169-3) and were conducted in compliance with the university guidelines and regulations for animal experimentation. For generation of Kastor^–/–, Polluks^–/–, Kastor^–/–/Polluks^–/–, Vdac3^–/–, Kastor^FLAG/+, and Polluks^FLAG/+ mice, ribonucleoprotein (RNP) was prepared by mixing the CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA) with recombinant Cas9 protein (Integrated DNA Technologies) (Supplementary Data 5). Single-stranded oligodeoxynucleotide (ssODN) homology repair templates were synthesized as 200-nt sequences (Supplementary Data 5). Mouse zygotes of the C57BL/6J strain were subjected to electroporation with each RNP with or without the corresponding ssODN. All mice were housed in the specific pathogen-free animal facility at Kyushu University in accordance with institutional guidelines under the following conditions: 22 °C ambient temperature, 50–60% humidity, 12 h dark/light cycle, and free access to water and rodent chow CA-1 (CLEA Japan). B6D2F1/Jcl (C57BL/6N Jcl × DBA/2N Jcl) female mice were used for the fertility test, and all other experiments were performed on the C57BL/6J background.

CRISPR/Cas9 gene-editing was used to ablate FKBP51 in HaCaT cells. Recombinant Cas9 protein and CRISPR crRNA were purchased from Integrated DNA Technologies (Coralville, IA). The gRNAs were designed using publicly accessible engines (http://crispr.mit.edu/; http://chopchop.cbu.uib.no/ (http://www.uib.no/en/persons/) as described [50 (link)–52 (link)]. Only top ranked gRNA with no off-target effects confirmed by two design sites were selected for the knock-out procedure (gRNA1, FKBP51 exon 2, ATTACCTCCAAAAAAGACAG; gRNA2, FKBP51 Exon 3, GGTGAGGAAACGCCGATGAT; gRNA3, FKBP51 Exon 4, GTCATCAAGGCATGGGACAT). HaCaT cells were transiently transfected with ribonucleoprotein complex (RNPC) using RNAi-Max transfection reagent (Fisher Scientific). The advantages of RNPC (with Cas9 protein and synthetic gRNAs) versus standard vector-based CRISPR approaches include rapid RNPC degradation after gene editing resulting in minimal Cas9-gRNA off-target effects and cytotoxicity. Single-cell colonies were established from CRISPR-edited cell cultures and analyzed by sequencing and Western blotting to verify the knock-out of FKBP51 gene. Cas9-only-treated cells were used as a control. Experiments were performed in two different FKBP51 KO clones (L1 and L2).